Mutagenetix > Incidental Mutation

Incidental Mutation 'R4580:Golga4'

343602

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

041599-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4580 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 118557259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1150 (Q1150K)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

probably benign
Transcript: ENSMUST00000084820
AA Change: Q1150K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: Q1150K

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000211840
AA Change: Q160K

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212913

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810408A11Rik	T	C	11: 69,900,411	Y114C	probably damaging	Het
4932438A13Rik	A	T	3: 37,030,025	T3864S	probably benign	Het
Abcc2	T	C	19: 43,811,119	S556P	probably damaging	Het
AI314180	T	C	4: 58,840,751	Y669C	probably damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Atp6v1g1	A	G	4: 63,550,032	N91D	probably benign	Het
BC005537	G	T	13: 24,803,411	A11S	probably benign	Het
BC049352	G	T	9: 45,244,128		probably null	Het
Bub1	A	C	2: 127,829,676		probably null	Het
Ccdc162	T	C	10: 41,561,140	T1758A	probably benign	Het
Cdh15	T	C	8: 122,865,158	L594P	probably damaging	Het
Cobll1	C	T	2: 65,151,073	V90I	probably benign	Het
Cog2	T	C	8: 124,545,136	V463A	probably benign	Het
Cpeb4	T	A	11: 31,927,757		probably null	Het
Creb5	G	A	6: 53,604,534	M172I	possibly damaging	Het
Cyp4a32	T	C	4: 115,602,929		silent	Het
Dnah8	T	A	17: 30,662,052	S588T	probably benign	Het
Esd	T	C	14: 74,742,077	V120A	possibly damaging	Het
Fbxo5	T	C	10: 5,805,255		probably null	Het
Gm4922	T	C	10: 18,783,684	D430G	probably benign	Het
Grb14	T	C	2: 64,953,603	N60S	probably benign	Het
Grk4	A	G	5: 34,660,981	N2S	probably damaging	Het
Henmt1	T	A	3: 108,942,765	S21R	probably benign	Het
Ifngr2	A	G	16: 91,558,018	K113E	probably benign	Het
Ighv15-2	T	A	12: 114,564,970	T15S	probably benign	Het
Kif24	A	G	4: 41,395,287	S529P	probably damaging	Het
Large2	T	C	2: 92,370,612	N51S	possibly damaging	Het
Lmtk2	A	G	5: 144,174,781	E773G	possibly damaging	Het
Lrfn3	A	T	7: 30,360,042	C253S	probably damaging	Het
Maea	T	C	5: 33,360,488	V130A	possibly damaging	Het
March11	A	T	15: 26,311,103	I222F	probably damaging	Het
Mast4	A	T	13: 102,737,258	Y1699*	probably null	Het
Mavs	G	T	2: 131,240,450	A85S	probably damaging	Het
Mpzl3	T	A	9: 45,068,231	V160E	possibly damaging	Het
Myh15	T	C	16: 49,065,025	S88P	possibly damaging	Het
Myl2	A	T	5: 122,106,738	H157L	probably benign	Het
Myo9b	A	G	8: 71,315,135	N284S	probably damaging	Het
Nphp1	A	G	2: 127,768,169		probably null	Het
Nrcam	T	C	12: 44,562,540		probably null	Het
Nt5c3b	G	T	11: 100,433,059	F134L	probably damaging	Het
Olfr1225	T	A	2: 89,171,200	Q4L	probably benign	Het
Otog	A	G	7: 46,287,801	R1645G	possibly damaging	Het
Pask	T	C	1: 93,322,108	I523M	probably benign	Het
Pcdhb7	T	A	18: 37,342,135	L108Q	probably damaging	Het
Pdp2	C	A	8: 104,594,944	T475K	probably damaging	Het
Pgbd1	G	C	13: 21,428,329	P113A	probably benign	Het
Plk5	C	T	10: 80,360,467	H291Y	possibly damaging	Het
Pmpca	G	T	2: 26,393,335	S382I	probably damaging	Het
Prl3b1	A	G	13: 27,249,467	T202A	possibly damaging	Het
Ptgs2	A	T	1: 150,104,094	T317S	possibly damaging	Het
Ptprc	C	T	1: 138,071,251	M1020I	probably benign	Het
Rhbdl3	T	C	11: 80,353,645	Y393H	probably damaging	Het
Sema3e	T	C	5: 14,233,703	L482P	probably damaging	Het
Setd2	C	T	9: 110,574,243	T1984I	probably benign	Het
Slc17a1	T	C	13: 23,887,977	Y393H	probably damaging	Het
Slc9a3	C	T	13: 74,158,886	R377*	probably null	Het
Slitrk3	A	G	3: 73,051,206	S78P	probably damaging	Het
Specc1	T	A	11: 62,219,331	V1054E	probably damaging	Het
Tbc1d4	T	C	14: 101,458,783	T847A	probably benign	Het
Tcf7l2	G	A	19: 55,919,036	G343R	probably damaging	Het
Tex36	A	C	7: 133,587,382	Y154D	possibly damaging	Het
Topaz1	T	A	9: 122,747,515	M57K	probably null	Het
Trav6-4	T	C	14: 53,454,699	Y85H	probably damaging	Het
Trim30d	A	G	7: 104,472,558	Y327H	possibly damaging	Het
Ttn	A	G	2: 76,951,396	V1056A	probably benign	Het
Usp32	C	A	11: 85,059,127		probably null	Het
Vmn1r59	A	T	7: 5,454,137	M208K	probably damaging	Het
Vmn2r25	T	C	6: 123,823,023	T787A	possibly damaging	Het
Vps39	A	T	2: 120,339,333	I246N	probably benign	Het
Xab2	T	C	8: 3,610,162	D855G	probably damaging	Het
Xpc	A	G	6: 91,500,011	S369P	probably benign	Het
Ythdc2	T	A	18: 44,858,198	C758S	possibly damaging	Het
Zfp62	A	G	11: 49,216,272	I397V	possibly damaging	Het
Zscan4d	A	G	7: 11,162,508	S312P	probably benign	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- AGAAGGTCCGCATAGTCCAG -3'
(R):5'- CTCAAGCAAGCTTTTGAGGTTC -3'

Sequencing Primer
(F):5'- GTCCGCATAGTCCAGTCTGAAAAAG -3'
(R):5'- AGCAAGCTTTTGAGGTTCAAGCTC -3'

Posted On

2015-09-24