Incidental Mutation 'R4580:Golga4'
ID 343602
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
MMRRC Submission 041599-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4580 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 118386327 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1150 (Q1150K)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
AlphaFold Q91VW5
Predicted Effect probably benign
Transcript: ENSMUST00000084820
AA Change: Q1150K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: Q1150K

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211840
AA Change: Q160K
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212913
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,791,237 (GRCm39) Y114C probably damaging Het
Abcc2 T C 19: 43,799,558 (GRCm39) S556P probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Atp6v1g1 A G 4: 63,468,269 (GRCm39) N91D probably benign Het
BC005537 G T 13: 24,987,394 (GRCm39) A11S probably benign Het
Bltp1 A T 3: 37,084,174 (GRCm39) T3864S probably benign Het
Bub1 A C 2: 127,671,596 (GRCm39) probably null Het
Ccdc162 T C 10: 41,437,136 (GRCm39) T1758A probably benign Het
Cdh15 T C 8: 123,591,897 (GRCm39) L594P probably damaging Het
Cobll1 C T 2: 64,981,417 (GRCm39) V90I probably benign Het
Cog2 T C 8: 125,271,875 (GRCm39) V463A probably benign Het
Cpeb4 T A 11: 31,877,757 (GRCm39) probably null Het
Creb5 G A 6: 53,581,519 (GRCm39) M172I possibly damaging Het
Cyp4a32 T C 4: 115,460,126 (GRCm39) silent Het
Dnah8 T A 17: 30,881,026 (GRCm39) S588T probably benign Het
Ecpas T C 4: 58,840,751 (GRCm39) Y669C probably damaging Het
Esd T C 14: 74,979,517 (GRCm39) V120A possibly damaging Het
Fbxo5 T C 10: 5,755,255 (GRCm39) probably null Het
Gm4922 T C 10: 18,659,432 (GRCm39) D430G probably benign Het
Grb14 T C 2: 64,783,947 (GRCm39) N60S probably benign Het
Grk4 A G 5: 34,818,325 (GRCm39) N2S probably damaging Het
Henmt1 T A 3: 108,850,081 (GRCm39) S21R probably benign Het
Ifngr2 A G 16: 91,354,906 (GRCm39) K113E probably benign Het
Ighv15-2 T A 12: 114,528,590 (GRCm39) T15S probably benign Het
Kif24 A G 4: 41,395,287 (GRCm39) S529P probably damaging Het
Large2 T C 2: 92,200,957 (GRCm39) N51S possibly damaging Het
Lmtk2 A G 5: 144,111,599 (GRCm39) E773G possibly damaging Het
Lrfn3 A T 7: 30,059,467 (GRCm39) C253S probably damaging Het
Maea T C 5: 33,517,832 (GRCm39) V130A possibly damaging Het
Marchf11 A T 15: 26,311,189 (GRCm39) I222F probably damaging Het
Mast4 A T 13: 102,873,766 (GRCm39) Y1699* probably null Het
Mavs G T 2: 131,082,370 (GRCm39) A85S probably damaging Het
Mpzl3 T A 9: 44,979,529 (GRCm39) V160E possibly damaging Het
Myh15 T C 16: 48,885,388 (GRCm39) S88P possibly damaging Het
Myl2 A T 5: 122,244,801 (GRCm39) H157L probably benign Het
Myo9b A G 8: 71,767,779 (GRCm39) N284S probably damaging Het
Nphp1 A G 2: 127,610,089 (GRCm39) probably null Het
Nrcam T C 12: 44,609,323 (GRCm39) probably null Het
Nt5c3b G T 11: 100,323,885 (GRCm39) F134L probably damaging Het
Or4c120 T A 2: 89,001,544 (GRCm39) Q4L probably benign Het
Otog A G 7: 45,937,225 (GRCm39) R1645G possibly damaging Het
Pask T C 1: 93,249,830 (GRCm39) I523M probably benign Het
Pcdhb7 T A 18: 37,475,188 (GRCm39) L108Q probably damaging Het
Pdp2 C A 8: 105,321,576 (GRCm39) T475K probably damaging Het
Pgbd1 G C 13: 21,612,499 (GRCm39) P113A probably benign Het
Plk5 C T 10: 80,196,301 (GRCm39) H291Y possibly damaging Het
Pmpca G T 2: 26,283,347 (GRCm39) S382I probably damaging Het
Prl3b1 A G 13: 27,433,450 (GRCm39) T202A possibly damaging Het
Ptgs2 A T 1: 149,979,845 (GRCm39) T317S possibly damaging Het
Ptprc C T 1: 137,998,989 (GRCm39) M1020I probably benign Het
Rhbdl3 T C 11: 80,244,471 (GRCm39) Y393H probably damaging Het
Sema3e T C 5: 14,283,717 (GRCm39) L482P probably damaging Het
Setd2 C T 9: 110,403,311 (GRCm39) T1984I probably benign Het
Slc17a1 T C 13: 24,071,960 (GRCm39) Y393H probably damaging Het
Slc9a3 C T 13: 74,307,005 (GRCm39) R377* probably null Het
Slitrk3 A G 3: 72,958,539 (GRCm39) S78P probably damaging Het
Smim35 G T 9: 45,155,426 (GRCm39) probably null Het
Specc1 T A 11: 62,110,157 (GRCm39) V1054E probably damaging Het
Tbc1d4 T C 14: 101,696,219 (GRCm39) T847A probably benign Het
Tcf7l2 G A 19: 55,907,468 (GRCm39) G343R probably damaging Het
Tex36 A C 7: 133,189,111 (GRCm39) Y154D possibly damaging Het
Topaz1 T A 9: 122,576,580 (GRCm39) M57K probably null Het
Trav6-4 T C 14: 53,692,156 (GRCm39) Y85H probably damaging Het
Trim30d A G 7: 104,121,765 (GRCm39) Y327H possibly damaging Het
Ttn A G 2: 76,781,740 (GRCm39) V1056A probably benign Het
Usp32 C A 11: 84,949,953 (GRCm39) probably null Het
Vmn1r59 A T 7: 5,457,136 (GRCm39) M208K probably damaging Het
Vmn2r25 T C 6: 123,799,982 (GRCm39) T787A possibly damaging Het
Vps39 A T 2: 120,169,814 (GRCm39) I246N probably benign Het
Xab2 T C 8: 3,660,162 (GRCm39) D855G probably damaging Het
Xpc A G 6: 91,476,993 (GRCm39) S369P probably benign Het
Ythdc2 T A 18: 44,991,265 (GRCm39) C758S possibly damaging Het
Zfp62 A G 11: 49,107,099 (GRCm39) I397V possibly damaging Het
Zscan4d A G 7: 10,896,435 (GRCm39) S312P probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118,382,521 (GRCm39) missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGAAGGTCCGCATAGTCCAG -3'
(R):5'- CTCAAGCAAGCTTTTGAGGTTC -3'

Sequencing Primer
(F):5'- GTCCGCATAGTCCAGTCTGAAAAAG -3'
(R):5'- AGCAAGCTTTTGAGGTTCAAGCTC -3'
Posted On 2015-09-24