Incidental Mutation 'R4580:2810408A11Rik'
ID343611
Institutional Source Beutler Lab
Gene Symbol 2810408A11Rik
Ensembl Gene ENSMUSG00000018570
Gene NameRIKEN cDNA 2810408A11 gene
Synonyms
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69897352-69900987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69900411 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 114 (Y114C)
Ref Sequence ENSEMBL: ENSMUSP00000098529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000018714] [ENSMUST00000061837] [ENSMUST00000100969] [ENSMUST00000102580] [ENSMUST00000108617] [ENSMUST00000108621] [ENSMUST00000128046] [ENSMUST00000129234] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000144431] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000001631
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000018714
AA Change: Y114C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018714
Gene: ENSMUSG00000018570
AA Change: Y114C

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100969
AA Change: Y114C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098529
Gene: ENSMUSG00000018570
AA Change: Y114C

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 272 5.7e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102580
AA Change: Y114C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099640
Gene: ENSMUSG00000018570
AA Change: Y114C

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 153 270 6.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108617
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108621
AA Change: Y114C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104261
Gene: ENSMUSG00000018570
AA Change: Y114C

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128046
SMART Domains Protein: ENSMUSP00000137547
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
Pfam:IPP-2 1 77 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129234
AA Change: Y114C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136835
Gene: ENSMUSG00000018570
AA Change: Y114C

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142121
Predicted Effect probably damaging
Transcript: ENSMUST00000144431
AA Change: Y114C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135926
Gene: ENSMUSG00000018570
AA Change: Y114C

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176614
Predicted Effect probably benign
Transcript: ENSMUST00000177138
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177160
Predicted Effect probably benign
Transcript: ENSMUST00000177476
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in 2810408A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0180:2810408A11Rik UTSW 11 69898876 missense probably benign 0.37
R1774:2810408A11Rik UTSW 11 69900627 missense probably damaging 0.98
R2034:2810408A11Rik UTSW 11 69900559 missense probably benign 0.00
R2085:2810408A11Rik UTSW 11 69900372 missense possibly damaging 0.92
R3016:2810408A11Rik UTSW 11 69899222 missense probably benign 0.00
R4831:2810408A11Rik UTSW 11 69900577 missense possibly damaging 0.46
R5868:2810408A11Rik UTSW 11 69897575 missense possibly damaging 0.92
R6129:2810408A11Rik UTSW 11 69898311 missense probably damaging 1.00
R7841:2810408A11Rik UTSW 11 69899286 missense probably benign 0.01
R7924:2810408A11Rik UTSW 11 69899286 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTAAAAGCTGAGTTGCTGC -3'
(R):5'- AGGTATGCAAACAGACACCG -3'

Sequencing Primer
(F):5'- CCCTGCCTTTCTACAATAAAGC -3'
(R):5'- AGTAGCCTTGCTTCGCG -3'
Posted On2015-09-24