Incidental Mutation 'R4580:Pgbd1'
ID343619
Institutional Source Beutler Lab
Gene Symbol Pgbd1
Ensembl Gene ENSMUSG00000055313
Gene NamepiggyBac transposable element derived 1
Synonyms4921509E05Rik
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21421275-21441058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 21428329 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 113 (P113A)
Ref Sequence ENSEMBL: ENSMUSP00000117669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099719] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect probably benign
Transcript: ENSMUST00000099719
AA Change: P113A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313
AA Change: P113A

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122872
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000145494
AA Change: P113A
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313
AA Change: P113A

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000148071
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151743
AA Change: P113A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313
AA Change: P113A

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. This gene product is specifically expressed in the brain, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Pgbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Pgbd1 APN 13 21423253 nonsense probably null
IGL03136:Pgbd1 APN 13 21433439 missense possibly damaging 0.46
R0206:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0208:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0420:Pgbd1 UTSW 13 21423166 missense possibly damaging 0.50
R0547:Pgbd1 UTSW 13 21423518 missense probably damaging 1.00
R0589:Pgbd1 UTSW 13 21434430 missense possibly damaging 0.92
R0854:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R0891:Pgbd1 UTSW 13 21422800 missense probably damaging 0.97
R1589:Pgbd1 UTSW 13 21423292 missense probably damaging 0.97
R1700:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R1815:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R2139:Pgbd1 UTSW 13 21423020 missense probably damaging 1.00
R3776:Pgbd1 UTSW 13 21428373 missense probably benign 0.00
R3870:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R3871:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R5644:Pgbd1 UTSW 13 21423152 missense probably damaging 0.99
R6480:Pgbd1 UTSW 13 21423476 missense probably benign 0.13
R6978:Pgbd1 UTSW 13 21423262 missense probably damaging 1.00
R7084:Pgbd1 UTSW 13 21423130 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ATTGGAGTGCCCTGGTAGAC -3'
(R):5'- GTGGTAGACTTTTGGAGACATTATC -3'

Sequencing Primer
(F):5'- AGTGCCCTGGTAGACTAACTCTG -3'
(R):5'- GCGACCACCAAAATAATTATTA -3'
Posted On2015-09-24