Incidental Mutation 'R4580:Esd'
ID343626
Institutional Source Beutler Lab
Gene Symbol Esd
Ensembl Gene ENSMUSG00000021996
Gene Nameesterase D/formylglutathione hydrolase
SynonymsEs10, Es-10, Esd
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location74732297-74750765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74742077 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000135394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022573] [ENSMUST00000175712] [ENSMUST00000175887] [ENSMUST00000176957] [ENSMUST00000177137] [ENSMUST00000177181] [ENSMUST00000177283]
Predicted Effect probably benign
Transcript: ENSMUST00000022573
AA Change: V107A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022573
Gene: ENSMUSG00000021996
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Esterase 23 275 8.1e-74 PFAM
Pfam:Chlorophyllase2 29 184 2.7e-8 PFAM
Pfam:Esterase_phd 30 231 1e-7 PFAM
Pfam:Abhydrolase_5 48 261 4.6e-9 PFAM
Pfam:Peptidase_S9 102 282 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175712
AA Change: V107A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134932
Gene: ENSMUSG00000021996
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Esterase 23 131 4.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175887
AA Change: V107A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135244
Gene: ENSMUSG00000021996
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Esterase 23 242 1.3e-57 PFAM
Pfam:Chlorophyllase2 29 186 2.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176484
Predicted Effect unknown
Transcript: ENSMUST00000176726
AA Change: V58A
Predicted Effect possibly damaging
Transcript: ENSMUST00000176957
AA Change: V120A

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135394
Gene: ENSMUSG00000021996
AA Change: V120A

DomainStartEndE-ValueType
Pfam:AXE1 26 198 1e-7 PFAM
Pfam:Esterase 36 288 6.6e-74 PFAM
Pfam:Abhydrolase_5 61 274 7.1e-9 PFAM
Pfam:Peptidase_S9 116 295 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177137
AA Change: V107A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135818
Gene: ENSMUSG00000021996
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Esterase 23 259 1.4e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.2e-8 PFAM
Pfam:Esterase_phd 30 231 7.9e-8 PFAM
Pfam:Abhydrolase_5 48 247 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177181
AA Change: V107A

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135035
Gene: ENSMUSG00000021996
AA Change: V107A

DomainStartEndE-ValueType
Pfam:Esterase 23 261 2e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.3e-8 PFAM
Pfam:Esterase_phd 30 231 8.4e-8 PFAM
Pfam:Abhydrolase_5 48 248 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177283
AA Change: V107A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135063
Gene: ENSMUSG00000021996
AA Change: V107A

DomainStartEndE-ValueType
Pfam:AXE1 16 185 1.1e-7 PFAM
Pfam:Esterase 23 247 1e-67 PFAM
Pfam:Chlorophyllase2 29 184 1.9e-8 PFAM
Pfam:Esterase_phd 30 231 2.5e-8 PFAM
Pfam:Abhydrolase_5 48 239 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177445
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tbc1d4 T C 14: 101,458,783 T847A probably benign Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Esd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Esd APN 14 74736027 missense probably damaging 1.00
IGL00534:Esd APN 14 74738461 missense probably damaging 0.99
IGL00904:Esd APN 14 74749688 makesense probably null
IGL01645:Esd APN 14 74749719 missense probably benign 0.00
IGL03117:Esd APN 14 74741246 missense probably damaging 1.00
R0766:Esd UTSW 14 74742121 missense probably damaging 1.00
R0939:Esd UTSW 14 74736027 missense probably damaging 1.00
R1862:Esd UTSW 14 74742074 missense probably damaging 1.00
R1892:Esd UTSW 14 74749673 missense probably damaging 0.96
R3922:Esd UTSW 14 74743227 missense probably benign 0.00
R4830:Esd UTSW 14 74741160 missense probably damaging 1.00
R4969:Esd UTSW 14 74744713 missense possibly damaging 0.76
R5211:Esd UTSW 14 74741192 missense probably damaging 1.00
R5335:Esd UTSW 14 74742113 missense probably damaging 0.99
R5810:Esd UTSW 14 74745611 missense probably damaging 1.00
R7024:Esd UTSW 14 74744662 missense probably damaging 1.00
R7759:Esd UTSW 14 74745567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTTCCATTGTGTGTAGACGC -3'
(R):5'- CTGCAGGAGCTATAATATTGGGAAATC -3'

Sequencing Primer
(F):5'- ATTTTACGACGTAGCCTAGGC -3'
(R):5'- GAGCTATAATATTGGGAAATCTTGGG -3'
Posted On2015-09-24