Incidental Mutation 'R4580:Tbc1d4'
ID343627
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene NameTBC1 domain family, member 4
Synonyms5930406J04Rik, AS160
MMRRC Submission 041599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4580 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location101442360-101609191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101458783 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 847 (T847A)
Ref Sequence ENSEMBL: ENSMUSP00000125509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]
Predicted Effect probably benign
Transcript: ENSMUST00000100340
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159484
Predicted Effect probably benign
Transcript: ENSMUST00000159664
SMART Domains Protein: ENSMUSP00000124734
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
SCOP:d1ddma_ 2 48 1e-6 SMART
Blast:PTB 2 58 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159668
Predicted Effect unknown
Transcript: ENSMUST00000159951
AA Change: T560A
SMART Domains Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083
AA Change: T560A

DomainStartEndE-ValueType
PTB 28 170 8.6e-22 SMART
Pfam:DUF3350 459 522 2.3e-31 PFAM
TBC 574 794 5.2e-77 SMART
Blast:TBC 819 877 7e-24 BLAST
Blast:TBC 882 936 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161304
Predicted Effect probably benign
Transcript: ENSMUST00000161991
AA Change: T847A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: T847A

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162617
AA Change: T910A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: T910A

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T C 11: 69,900,411 Y114C probably damaging Het
4932438A13Rik A T 3: 37,030,025 T3864S probably benign Het
Abcc2 T C 19: 43,811,119 S556P probably damaging Het
AI314180 T C 4: 58,840,751 Y669C probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp6v1g1 A G 4: 63,550,032 N91D probably benign Het
BC005537 G T 13: 24,803,411 A11S probably benign Het
BC049352 G T 9: 45,244,128 probably null Het
Bub1 A C 2: 127,829,676 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cdh15 T C 8: 122,865,158 L594P probably damaging Het
Cobll1 C T 2: 65,151,073 V90I probably benign Het
Cog2 T C 8: 124,545,136 V463A probably benign Het
Cpeb4 T A 11: 31,927,757 probably null Het
Creb5 G A 6: 53,604,534 M172I possibly damaging Het
Cyp4a32 T C 4: 115,602,929 silent Het
Dnah8 T A 17: 30,662,052 S588T probably benign Het
Esd T C 14: 74,742,077 V120A possibly damaging Het
Fbxo5 T C 10: 5,805,255 probably null Het
Gm4922 T C 10: 18,783,684 D430G probably benign Het
Golga4 C A 9: 118,557,259 Q1150K probably benign Het
Grb14 T C 2: 64,953,603 N60S probably benign Het
Grk4 A G 5: 34,660,981 N2S probably damaging Het
Henmt1 T A 3: 108,942,765 S21R probably benign Het
Ifngr2 A G 16: 91,558,018 K113E probably benign Het
Ighv15-2 T A 12: 114,564,970 T15S probably benign Het
Kif24 A G 4: 41,395,287 S529P probably damaging Het
Large2 T C 2: 92,370,612 N51S possibly damaging Het
Lmtk2 A G 5: 144,174,781 E773G possibly damaging Het
Lrfn3 A T 7: 30,360,042 C253S probably damaging Het
Maea T C 5: 33,360,488 V130A possibly damaging Het
March11 A T 15: 26,311,103 I222F probably damaging Het
Mast4 A T 13: 102,737,258 Y1699* probably null Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mpzl3 T A 9: 45,068,231 V160E possibly damaging Het
Myh15 T C 16: 49,065,025 S88P possibly damaging Het
Myl2 A T 5: 122,106,738 H157L probably benign Het
Myo9b A G 8: 71,315,135 N284S probably damaging Het
Nphp1 A G 2: 127,768,169 probably null Het
Nrcam T C 12: 44,562,540 probably null Het
Nt5c3b G T 11: 100,433,059 F134L probably damaging Het
Olfr1225 T A 2: 89,171,200 Q4L probably benign Het
Otog A G 7: 46,287,801 R1645G possibly damaging Het
Pask T C 1: 93,322,108 I523M probably benign Het
Pcdhb7 T A 18: 37,342,135 L108Q probably damaging Het
Pdp2 C A 8: 104,594,944 T475K probably damaging Het
Pgbd1 G C 13: 21,428,329 P113A probably benign Het
Plk5 C T 10: 80,360,467 H291Y possibly damaging Het
Pmpca G T 2: 26,393,335 S382I probably damaging Het
Prl3b1 A G 13: 27,249,467 T202A possibly damaging Het
Ptgs2 A T 1: 150,104,094 T317S possibly damaging Het
Ptprc C T 1: 138,071,251 M1020I probably benign Het
Rhbdl3 T C 11: 80,353,645 Y393H probably damaging Het
Sema3e T C 5: 14,233,703 L482P probably damaging Het
Setd2 C T 9: 110,574,243 T1984I probably benign Het
Slc17a1 T C 13: 23,887,977 Y393H probably damaging Het
Slc9a3 C T 13: 74,158,886 R377* probably null Het
Slitrk3 A G 3: 73,051,206 S78P probably damaging Het
Specc1 T A 11: 62,219,331 V1054E probably damaging Het
Tcf7l2 G A 19: 55,919,036 G343R probably damaging Het
Tex36 A C 7: 133,587,382 Y154D possibly damaging Het
Topaz1 T A 9: 122,747,515 M57K probably null Het
Trav6-4 T C 14: 53,454,699 Y85H probably damaging Het
Trim30d A G 7: 104,472,558 Y327H possibly damaging Het
Ttn A G 2: 76,951,396 V1056A probably benign Het
Usp32 C A 11: 85,059,127 probably null Het
Vmn1r59 A T 7: 5,454,137 M208K probably damaging Het
Vmn2r25 T C 6: 123,823,023 T787A possibly damaging Het
Vps39 A T 2: 120,339,333 I246N probably benign Het
Xab2 T C 8: 3,610,162 D855G probably damaging Het
Xpc A G 6: 91,500,011 S369P probably benign Het
Ythdc2 T A 18: 44,858,198 C758S possibly damaging Het
Zfp62 A G 11: 49,216,272 I397V possibly damaging Het
Zscan4d A G 7: 11,162,508 S312P probably benign Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101608112 missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101444566 missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101449193 splice site probably benign
IGL01144:Tbc1d4 APN 14 101444663 missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101608015 missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101489864 nonsense probably null
IGL02177:Tbc1d4 APN 14 101454939 missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101465730 missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101501100 missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101458113 missense probably damaging 1.00
R0396:Tbc1d4 UTSW 14 101458063 splice site probably null
R0787:Tbc1d4 UTSW 14 101449209 missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101479220 splice site probably benign
R1167:Tbc1d4 UTSW 14 101608019 missense probably damaging 1.00
R1456:Tbc1d4 UTSW 14 101507106 missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101475215 missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101507138 missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101477155 missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101494411 missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101494361 missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101458755 missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101507213 missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101608336 missense probably damaging 1.00
R4664:Tbc1d4 UTSW 14 101462827 intron probably benign
R4872:Tbc1d4 UTSW 14 101444708 missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101507231 missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101458882 nonsense probably null
R5180:Tbc1d4 UTSW 14 101507572 missense probably damaging 1.00
R5366:Tbc1d4 UTSW 14 101607976 missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101455008 missense probably damaging 1.00
R6057:Tbc1d4 UTSW 14 101489917 missense probably damaging 0.99
R6180:Tbc1d4 UTSW 14 101458770 missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101507174 missense probably damaging 0.97
R6509:Tbc1d4 UTSW 14 101608318 missense possibly damaging 0.92
R6791:Tbc1d4 UTSW 14 101608259 missense probably damaging 0.98
R7001:Tbc1d4 UTSW 14 101458749 missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101487441 missense probably damaging 1.00
R7575:Tbc1d4 UTSW 14 101447589 missense probably damaging 1.00
R7691:Tbc1d4 UTSW 14 101507641 missense probably damaging 1.00
Z1088:Tbc1d4 UTSW 14 101452423 missense probably damaging 1.00
Z1176:Tbc1d4 UTSW 14 101507087 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATCCATCTACACAGCATTTGTAC -3'
(R):5'- GCAAGCAGCCGATTTCTAAAAG -3'

Sequencing Primer
(F):5'- ATCTACACAGCATTTGTACTTTCC -3'
(R):5'- GCAGCCGATTTCTAAAAGTAATTGGG -3'
Posted On2015-09-24