Mutagenetix > Incidental Mutations

Incidental Mutation 'R4581:Arhgef4'

343637

Institutional Source

Beutler Lab

Gene Symbol

Arhgef4

Ensembl Gene

ENSMUSG00000037509

Gene Name

Rho guanine nucleotide exchange factor (GEF) 4

Synonyms

9330140K16Rik, Asef

MMRRC Submission

041802-MU

Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34678188-34813309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34732124 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1171 (E1171K)

Ref Sequence

ENSEMBL: ENSMUSP00000124213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159747] [ENSMUST00000162599]

AlphaFold

Q7TNR9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159747
AA Change: E1171K

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: E1171K

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	686	712	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	1119	1137	N/A	INTRINSIC
low complexity region	1240	1254	N/A	INTRINSIC
SH3	1361	1416	3.73e-16	SMART
RhoGEF	1453	1632	3.86e-56	SMART
PH	1665	1773	2.33e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162599
AA Change: E4K

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: E4K

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
SH3	194	249	3.73e-16	SMART
Pfam:RhoGEF	304	405	1.2e-25	PFAM
PH	438	546	2.33e-14	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Arhgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Arhgef4	APN	1	34811696	missense	possibly damaging	0.88
IGL02376:Arhgef4	APN	1	34806059	missense	probably damaging	1.00
IGL02604:Arhgef4	APN	1	34811723	nonsense	probably null
IGL03240:Arhgef4	APN	1	34806026	missense	probably benign	0.03
BB004:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
BB014:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R0095:Arhgef4	UTSW	1	34732370	nonsense	probably null
R0157:Arhgef4	UTSW	1	34806394	missense	probably damaging	1.00
R0243:Arhgef4	UTSW	1	34806999	splice site	probably null
R0383:Arhgef4	UTSW	1	34810533	missense	probably damaging	1.00
R0440:Arhgef4	UTSW	1	34745448	splice site	probably null
R0452:Arhgef4	UTSW	1	34732322	missense	probably damaging	0.97
R0893:Arhgef4	UTSW	1	34807110	missense	probably damaging	1.00
R1429:Arhgef4	UTSW	1	34810339	missense	probably damaging	1.00
R1437:Arhgef4	UTSW	1	34723945	missense	unknown
R1669:Arhgef4	UTSW	1	34732158	missense	possibly damaging	0.86
R1780:Arhgef4	UTSW	1	34724160	missense	possibly damaging	0.73
R1809:Arhgef4	UTSW	1	34810555	critical splice donor site	probably null
R1879:Arhgef4	UTSW	1	34722440	missense	unknown
R1908:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01
R1919:Arhgef4	UTSW	1	34811140	missense	probably damaging	0.98
R2020:Arhgef4	UTSW	1	34723810	missense	unknown
R2058:Arhgef4	UTSW	1	34722377	missense	unknown
R2213:Arhgef4	UTSW	1	34807149	splice site	probably null
R2851:Arhgef4	UTSW	1	34724048	missense	unknown
R2852:Arhgef4	UTSW	1	34724048	missense	unknown
R2853:Arhgef4	UTSW	1	34724048	missense	unknown
R3697:Arhgef4	UTSW	1	34722440	missense	unknown
R4012:Arhgef4	UTSW	1	34725106	missense	possibly damaging	0.75
R4118:Arhgef4	UTSW	1	34732347	missense	probably damaging	0.98
R4133:Arhgef4	UTSW	1	34806104	missense	probably damaging	1.00
R4534:Arhgef4	UTSW	1	34723081	missense	unknown
R4535:Arhgef4	UTSW	1	34723081	missense	unknown
R4665:Arhgef4	UTSW	1	34806032	missense	possibly damaging	0.89
R4678:Arhgef4	UTSW	1	34722668	missense	unknown
R4684:Arhgef4	UTSW	1	34811785	splice site	probably null
R4706:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
R4745:Arhgef4	UTSW	1	34807275	missense	probably damaging	1.00
R4747:Arhgef4	UTSW	1	34723274	missense	unknown
R4988:Arhgef4	UTSW	1	34723454	missense	unknown
R5063:Arhgef4	UTSW	1	34724215	missense	probably benign	0.00
R5154:Arhgef4	UTSW	1	34732374	missense	probably benign	0.43
R5156:Arhgef4	UTSW	1	34723274	missense	unknown
R5263:Arhgef4	UTSW	1	34724997	missense	possibly damaging	0.84
R5450:Arhgef4	UTSW	1	34807324	intron	probably benign
R5807:Arhgef4	UTSW	1	34807615	intron	probably benign
R5863:Arhgef4	UTSW	1	34722845	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6034:Arhgef4	UTSW	1	34721903	missense	unknown
R6311:Arhgef4	UTSW	1	34723981	missense	unknown
R6315:Arhgef4	UTSW	1	34723477	missense	unknown
R6316:Arhgef4	UTSW	1	34723477	missense	unknown
R6318:Arhgef4	UTSW	1	34723477	missense	unknown
R6323:Arhgef4	UTSW	1	34723477	missense	unknown
R6324:Arhgef4	UTSW	1	34723477	missense	unknown
R6325:Arhgef4	UTSW	1	34723477	missense	unknown
R6340:Arhgef4	UTSW	1	34732223	missense	probably damaging	1.00
R6835:Arhgef4	UTSW	1	34806493	missense	probably damaging	1.00
R6981:Arhgef4	UTSW	1	34722452	missense	unknown
R7087:Arhgef4	UTSW	1	34811686	missense	probably damaging	0.96
R7297:Arhgef4	UTSW	1	34807192	missense	probably damaging	1.00
R7525:Arhgef4	UTSW	1	34809704	missense	probably damaging	1.00
R7614:Arhgef4	UTSW	1	34732235	missense	possibly damaging	0.67
R7693:Arhgef4	UTSW	1	34724141	missense	probably benign	0.01
R7892:Arhgef4	UTSW	1	34721804	missense	unknown
R7895:Arhgef4	UTSW	1	34806397	missense	probably damaging	1.00
R7927:Arhgef4	UTSW	1	34807253	missense	probably damaging	1.00
R7965:Arhgef4	UTSW	1	34811681	missense	probably benign
R7973:Arhgef4	UTSW	1	34724437	missense	possibly damaging	0.83
R7979:Arhgef4	UTSW	1	34721897	missense	unknown
R8160:Arhgef4	UTSW	1	34723574	missense	unknown
R8175:Arhgef4	UTSW	1	34810374	missense	probably benign
R8178:Arhgef4	UTSW	1	34722902	missense	unknown
R9046:Arhgef4	UTSW	1	34811765	missense	possibly damaging	0.92
R9077:Arhgef4	UTSW	1	34721743	missense	unknown
R9209:Arhgef4	UTSW	1	34725160	critical splice donor site	probably null
R9209:Arhgef4	UTSW	1	34810495	missense	probably benign
R9355:Arhgef4	UTSW	1	34810549	missense	probably benign	0.02
RF012:Arhgef4	UTSW	1	34724484	small deletion	probably benign
X0062:Arhgef4	UTSW	1	34724227	missense	probably benign	0.35
YA93:Arhgef4	UTSW	1	34732217	missense	probably benign	0.00
Z1176:Arhgef4	UTSW	1	34723729	missense	unknown
Z1176:Arhgef4	UTSW	1	34804926	missense	probably damaging	1.00
Z1177:Arhgef4	UTSW	1	34722921	missense	unknown
Z1177:Arhgef4	UTSW	1	34723366	missense	unknown
Z1177:Arhgef4	UTSW	1	34724259	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATTCGGCCCTTGACCAAATC -3'
(R):5'- TCGAAGCTGAAGTGTGAGTG -3'

Sequencing Primer
(F):5'- GACCAAATCAGAAGGCTTTCTTGTC -3'
(R):5'- CGAAGCTGAAGTGTGAGTGTTGAG -3'

Posted On

2015-09-24