Incidental Mutation 'R4581:Plcd4'
ID 343639
Institutional Source Beutler Lab
Gene Symbol Plcd4
Ensembl Gene ENSMUSG00000026173
Gene Name phospholipase C, delta 4
Synonyms 4921507K24Rik
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74542888-74567794 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74548224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 48 (W48R)
Ref Sequence ENSEMBL: ENSMUSP00000121732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027362] [ENSMUST00000067916] [ENSMUST00000113747] [ENSMUST00000113749] [ENSMUST00000113750] [ENSMUST00000141412] [ENSMUST00000152707] [ENSMUST00000189257]
AlphaFold Q8K3R3
Predicted Effect probably damaging
Transcript: ENSMUST00000027362
AA Change: W48R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027362
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067916
AA Change: W48R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113745
SMART Domains Protein: ENSMUSP00000109374
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113747
AA Change: W48R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109376
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113749
AA Change: W48R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113750
AA Change: W48R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109379
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 7.16e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141412
AA Change: W48R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152707
AA Change: W48R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121732
Gene: ENSMUSG00000026173
AA Change: W48R

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185411
Predicted Effect probably benign
Transcript: ENSMUST00000189257
SMART Domains Protein: ENSMUSP00000140670
Gene: ENSMUSG00000033364

DomainStartEndE-ValueType
PDB:3U12|B 4 125 2e-71 PDB
low complexity region 182 200 N/A INTRINSIC
Pfam:UCH_1 341 608 4.3e-19 PFAM
low complexity region 628 646 N/A INTRINSIC
UIM 704 723 1.33e1 SMART
UIM 806 825 1.04e-1 SMART
UIM 828 847 2.11e-2 SMART
low complexity region 893 909 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the delta class of phospholipase C enzymes. Phospholipase C enzymes play a critical role in many cellular processes by hydrolyzing phosphatidylinositol 4,5-bisphosphate into two intracellular second messengers, inositol 1,4,5-trisphosphate and diacylglycerol. Expression of this gene may be a marker for cancer. [provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile or sterile. Sperm from mutant males fail to initiate the acrosome reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Plcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Plcd4 APN 1 74552115 missense probably damaging 1.00
IGL01806:Plcd4 APN 1 74552033 missense probably benign 0.42
IGL02537:Plcd4 APN 1 74556050 missense possibly damaging 0.55
IGL02574:Plcd4 APN 1 74564380 missense probably damaging 1.00
IGL02812:Plcd4 APN 1 74557808 missense probably damaging 1.00
IGL03350:Plcd4 APN 1 74549301 missense probably damaging 1.00
R0415:Plcd4 UTSW 1 74552097 missense probably damaging 0.99
R1699:Plcd4 UTSW 1 74548235 missense probably benign 0.01
R1852:Plcd4 UTSW 1 74549361 missense possibly damaging 0.92
R2120:Plcd4 UTSW 1 74564425 missense probably benign 0.00
R2125:Plcd4 UTSW 1 74565152 missense probably damaging 1.00
R3023:Plcd4 UTSW 1 74548192 missense probably damaging 1.00
R3157:Plcd4 UTSW 1 74551154 splice site probably null
R4535:Plcd4 UTSW 1 74563468 missense probably damaging 1.00
R4863:Plcd4 UTSW 1 74565802 splice site probably null
R4911:Plcd4 UTSW 1 74564413 missense possibly damaging 0.78
R4987:Plcd4 UTSW 1 74547959 unclassified probably benign
R5102:Plcd4 UTSW 1 74565154 missense probably damaging 1.00
R5752:Plcd4 UTSW 1 74547972 splice site probably null
R5887:Plcd4 UTSW 1 74551090 missense probably damaging 1.00
R6318:Plcd4 UTSW 1 74563594 missense possibly damaging 0.61
R6648:Plcd4 UTSW 1 74552013 missense probably benign 0.00
R6796:Plcd4 UTSW 1 74562070 missense probably benign 0.03
R6920:Plcd4 UTSW 1 74565835 unclassified probably benign
R7047:Plcd4 UTSW 1 74551989 missense possibly damaging 0.87
R7121:Plcd4 UTSW 1 74565365 missense probably benign
R7134:Plcd4 UTSW 1 74554503 missense probably benign 0.05
R7270:Plcd4 UTSW 1 74554679 missense possibly damaging 0.89
R7344:Plcd4 UTSW 1 74554652 missense probably damaging 1.00
R7363:Plcd4 UTSW 1 74551072 missense probably null 0.99
R7749:Plcd4 UTSW 1 74565133 missense possibly damaging 0.60
R7980:Plcd4 UTSW 1 74565305 missense probably benign 0.00
R8240:Plcd4 UTSW 1 74554501 missense probably benign 0.38
R8762:Plcd4 UTSW 1 74552054 missense possibly damaging 0.71
R9000:Plcd4 UTSW 1 74561865 nonsense probably null
R9114:Plcd4 UTSW 1 74552148 missense possibly damaging 0.60
R9162:Plcd4 UTSW 1 74562203 missense probably benign 0.00
R9252:Plcd4 UTSW 1 74549200 missense probably damaging 0.97
Z1176:Plcd4 UTSW 1 74548126 missense probably benign 0.04
Z1176:Plcd4 UTSW 1 74557792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGCCCCTGGTTCCAGAG -3'
(R):5'- ACAGGGCTGGCACAATATTG -3'

Sequencing Primer
(F):5'- AGAGTTCCTCTGGGCCC -3'
(R):5'- TCACATATTAGCTCGGCGAG -3'
Posted On 2015-09-24