Incidental Mutation 'R0058:Olfr323'
ID34364
Institutional Source Beutler Lab
Gene Symbol Olfr323
Ensembl Gene ENSMUSG00000043880
Gene Nameolfactory receptor 323
SynonymsMOR107-1, GA_x6K02T2NKPP-794386-795357
MMRRC Submission 038352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0058 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58624159-58630501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58625668 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000151137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070804] [ENSMUST00000203173] [ENSMUST00000214132]
Predicted Effect probably damaging
Transcript: ENSMUST00000070804
AA Change: I126N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068147
Gene: ENSMUSG00000043880
AA Change: I126N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-54 PFAM
Pfam:7tm_1 41 290 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203173
SMART Domains Protein: ENSMUSP00000145459
Gene: ENSMUSG00000043880

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214132
AA Change: I126N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.2396 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,290,842 V270G probably damaging Het
Acss1 A T 2: 150,628,539 W394R probably damaging Het
Adgrv1 A G 13: 81,182,672 V6088A possibly damaging Het
Ankrd36 A G 11: 5,630,691 probably benign Het
Anxa1 A T 19: 20,383,777 Y84N probably damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Avpr1b A G 1: 131,599,786 T16A probably benign Het
Bpifb1 G A 2: 154,206,540 R165H possibly damaging Het
Cables1 A G 18: 11,923,413 E316G possibly damaging Het
Cadm1 A T 9: 47,850,331 I427L probably damaging Het
Ccdc97 T C 7: 25,715,980 D86G probably benign Het
Cgnl1 C A 9: 71,641,397 D1081Y probably damaging Het
Cgnl1 T A 9: 71,724,840 R410W probably damaging Het
Cntnap4 G A 8: 112,785,784 E593K probably damaging Het
Dazap1 T C 10: 80,261,581 probably benign Het
Dip2b A G 15: 100,215,240 E1512G probably benign Het
Dock1 G A 7: 135,108,761 V1171M possibly damaging Het
Dock5 A T 14: 67,781,036 F1230Y probably benign Het
Dym G A 18: 75,043,172 E15K possibly damaging Het
Ednra C A 8: 77,667,322 probably null Het
Faf1 A G 4: 109,736,624 Q133R probably benign Het
Fbxw28 A G 9: 109,328,211 I323T probably benign Het
Fcer2a T C 8: 3,688,111 probably benign Het
Fmo2 A T 1: 162,886,324 S204R probably benign Het
Frmd4b A G 6: 97,423,499 V63A probably damaging Het
Fzd8 G A 18: 9,213,985 A356T possibly damaging Het
Ghitm A G 14: 37,131,592 L97P probably damaging Het
Gins4 A G 8: 23,229,510 probably benign Het
Golga3 T A 5: 110,202,777 F766Y possibly damaging Het
Hapln1 T C 13: 89,607,878 I267T probably benign Het
Helz A T 11: 107,672,558 probably benign Het
Herc2 T C 7: 56,170,483 V2851A possibly damaging Het
Igkv8-18 G A 6: 70,356,121 probably benign Het
Igll1 A T 16: 16,863,876 V5E probably benign Het
Irx3 T C 8: 91,800,540 T179A possibly damaging Het
Kif16b A G 2: 142,857,305 probably null Het
Limk1 A T 5: 134,659,871 W507R probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mtif3 C A 5: 146,956,921 V159F probably benign Het
Myh6 C T 14: 54,963,404 R169Q probably damaging Het
Ncoa7 T A 10: 30,647,541 D887V probably damaging Het
Obox7 C T 7: 14,664,388 P76S probably benign Het
Olfr1335 A G 4: 118,809,480 M128T probably benign Het
Pitpnm2 G A 5: 124,124,030 A862V probably damaging Het
Pkd1 G C 17: 24,564,703 A162P probably benign Het
Plce1 A G 19: 38,525,184 D309G possibly damaging Het
Plk4 T C 3: 40,805,872 V401A probably benign Het
Prdx3 T C 19: 60,874,512 probably benign Het
Prrc2c C T 1: 162,698,884 V253I unknown Het
Ranbp2 T A 10: 58,480,531 S2358T probably damaging Het
Setd2 T A 9: 110,594,426 V2183E probably damaging Het
Sgsm1 T A 5: 113,285,087 S232C probably damaging Het
Skint6 A T 4: 113,046,815 probably benign Het
Slc15a2 A G 16: 36,754,547 I531T probably benign Het
Slc36a1 C T 11: 55,221,994 probably benign Het
Sorbs2 T A 8: 45,785,254 probably null Het
Sorbs2 C A 8: 45,796,263 D831E probably damaging Het
Sptan1 T C 2: 29,993,696 probably null Het
Stam T C 2: 14,138,141 C336R probably damaging Het
Stil G T 4: 115,041,298 A1042S probably damaging Het
Stxbp5l T A 16: 37,142,374 D773V possibly damaging Het
Sugct A T 13: 17,672,581 L39Q probably damaging Het
Tep1 A G 14: 50,834,065 V2041A possibly damaging Het
Tex15 C T 8: 33,581,502 probably benign Het
Tlr9 T G 9: 106,224,965 L485R possibly damaging Het
Tmem207 A G 16: 26,524,829 probably benign Het
Triml2 T C 8: 43,185,269 probably benign Het
Trip6 A G 5: 137,310,845 probably benign Het
Tspear T C 10: 77,869,631 F288L probably benign Het
Vmn1r179 C T 7: 23,929,167 T261I possibly damaging Het
Zfp644 A T 5: 106,637,003 S559R possibly damaging Het
Other mutations in Olfr323
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02995:Olfr323 APN 11 58625281 missense possibly damaging 0.92
IGL03118:Olfr323 APN 11 58625443 missense probably damaging 0.99
R0335:Olfr323 UTSW 11 58625740 missense probably damaging 1.00
R1127:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R2029:Olfr323 UTSW 11 58625493 missense probably damaging 1.00
R2434:Olfr323 UTSW 11 58625111 missense possibly damaging 0.95
R5483:Olfr323 UTSW 11 58625957 missense possibly damaging 0.95
R6423:Olfr323 UTSW 11 58625363 missense probably damaging 1.00
R6990:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R7472:Olfr323 UTSW 11 58625434 missense probably damaging 1.00
R7539:Olfr323 UTSW 11 58625956 missense probably damaging 1.00
R7635:Olfr323 UTSW 11 58625164 missense unknown
R7647:Olfr323 UTSW 11 58625203 missense probably damaging 1.00
R8519:Olfr323 UTSW 11 58625974 missense probably damaging 1.00
R8869:Olfr323 UTSW 11 58625168 missense unknown
Z1186:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1186:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1186:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1186:Olfr323 UTSW 11 58625793 missense probably benign
Z1186:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Z1187:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1187:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1187:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1187:Olfr323 UTSW 11 58625793 missense probably benign
Z1187:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Z1188:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1188:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1188:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1188:Olfr323 UTSW 11 58625793 missense probably benign
Z1188:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Z1189:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1189:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1189:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1189:Olfr323 UTSW 11 58625793 missense probably benign
Z1189:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Z1190:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1190:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1190:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1190:Olfr323 UTSW 11 58625793 missense probably benign
Z1190:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Z1191:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1191:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1191:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1191:Olfr323 UTSW 11 58625793 missense probably benign
Z1191:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Z1192:Olfr323 UTSW 11 58625249 missense probably benign 0.16
Z1192:Olfr323 UTSW 11 58625304 missense probably benign 0.16
Z1192:Olfr323 UTSW 11 58625762 missense probably benign 0.00
Z1192:Olfr323 UTSW 11 58625793 missense probably benign
Z1192:Olfr323 UTSW 11 58625906 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCATTTGGGCGCACATACATGGAG -3'
(R):5'- GAGATTTGGTACACATCCACCACGG -3'

Sequencing Primer
(F):5'- TTCTGTCACATAGACACTGGAGC -3'
(R):5'- GTACCCCTGCTGCTGTC -3'
Posted On2013-05-09