Incidental Mutation 'R4581:Cacna1s'
ID343641
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 041802-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4581 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 136070970 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect probably damaging
Transcript: ENSMUST00000112064
AA Change: L201Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: L201Q

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112068
AA Change: L201Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: L201Q

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160641
AA Change: L201Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: L201Q

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161865
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
BB009:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
BB019:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
R7357:Cacna1s UTSW 1 136071021 missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136092633 missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136086802 missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136085449 nonsense probably null
R7519:Cacna1s UTSW 1 136070756 missense probably damaging 0.99
R7675:Cacna1s UTSW 1 136110874 missense probably damaging 1.00
R7746:Cacna1s UTSW 1 136069018 missense probably damaging 0.99
R7779:Cacna1s UTSW 1 136119029 missense probably damaging 1.00
R7850:Cacna1s UTSW 1 136071048 missense probably damaging 1.00
R7932:Cacna1s UTSW 1 136084359 missense probably damaging 0.99
R7935:Cacna1s UTSW 1 136092595 missense possibly damaging 0.62
R7950:Cacna1s UTSW 1 136100625 missense probably benign 0.01
R7969:Cacna1s UTSW 1 136076732 missense probably damaging 1.00
R8083:Cacna1s UTSW 1 136095791 missense possibly damaging 0.91
R8101:Cacna1s UTSW 1 136118665 missense probably benign 0.02
R8123:Cacna1s UTSW 1 136108179 missense probably damaging 1.00
R8191:Cacna1s UTSW 1 136108155 missense probably damaging 1.00
R8194:Cacna1s UTSW 1 136077692 missense probably benign 0.33
R8251:Cacna1s UTSW 1 136086723 missense probably damaging 1.00
R8265:Cacna1s UTSW 1 136092626 nonsense probably null
R8310:Cacna1s UTSW 1 136087337 missense probably damaging 1.00
R8359:Cacna1s UTSW 1 136116061 missense probably benign 0.21
R8461:Cacna1s UTSW 1 136073702 missense possibly damaging 0.53
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Z1176:Cacna1s UTSW 1 136107084 nonsense probably null
Z1177:Cacna1s UTSW 1 136117686 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACAGTGTCTCTTCTCCCAAGC -3'
(R):5'- TCCAAGGTGCATTAGTGGAG -3'

Sequencing Primer
(F):5'- AAGCCCTCCTTTGCCCC -3'
(R):5'- GGCTTTGACCCCGAGCTTC -3'
Posted On2015-09-24