Incidental Mutation 'R4581:Olfr1082'
ID 343644
Institutional Source Beutler Lab
Gene Symbol Olfr1082
Ensembl Gene ENSMUSG00000111689
Gene Name olfactory receptor 1082
Synonyms GA_x6K02T2Q125-48079993-48079157, MOR192-4_p
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86593412-86598966 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86594228 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 200 (M200K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215600]
AlphaFold A0A1L1SUC9
Predicted Effect probably benign
Transcript: ENSMUST00000111578
AA Change: M200K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107204
Gene: ENSMUSG00000079239
AA Change: M200K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.6e-31 PFAM
Pfam:7tm_4 139 283 4.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215600
AA Change: M200K

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Olfr1082
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0483:Olfr1082 UTSW 2 86594408 missense probably benign 0.07
R0675:Olfr1082 UTSW 2 86594079 missense probably benign 0.00
R0718:Olfr1082 UTSW 2 86594081 missense probably benign 0.01
R0727:Olfr1082 UTSW 2 86594380 nonsense probably null
R1517:Olfr1082 UTSW 2 86594604 missense probably damaging 0.99
R1850:Olfr1082 UTSW 2 86594104 nonsense probably null
R2430:Olfr1082 UTSW 2 86594708 missense probably benign 0.00
R2474:Olfr1082 UTSW 2 86594613 missense probably benign 0.00
R3009:Olfr1082 UTSW 2 86594370 missense probably benign 0.07
R3122:Olfr1082 UTSW 2 86594610 missense possibly damaging 0.91
R4006:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4007:Olfr1082 UTSW 2 86594564 missense probably benign 0.14
R4762:Olfr1082 UTSW 2 86594037 missense possibly damaging 0.60
R5617:Olfr1082 UTSW 2 86594001 missense probably benign 0.07
R6118:Olfr1082 UTSW 2 86594414 missense probably benign
R6140:Olfr1082 UTSW 2 86594104 nonsense probably null
R6313:Olfr1082 UTSW 2 86594067 missense possibly damaging 0.76
R6528:Olfr1082 UTSW 2 86594465 missense probably damaging 1.00
R6785:Olfr1082 UTSW 2 86594421 missense probably damaging 0.98
R6792:Olfr1082 UTSW 2 86593939 missense probably benign 0.09
R6857:Olfr1082 UTSW 2 86594264 missense probably damaging 1.00
R6998:Olfr1082 UTSW 2 86594144 missense probably damaging 1.00
R7241:Olfr1082 UTSW 2 86594154 missense possibly damaging 0.89
R8790:Olfr1082 UTSW 2 86593934 missense possibly damaging 0.76
R8865:Olfr1082 UTSW 2 86594400 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGTAGATCAGGGGATTCAATAAGG -3'
(R):5'- TGGCCATATGTAAGCCTCTGC -3'

Sequencing Primer
(F):5'- GTATCAATTGAATGGCTAGATACAGG -3'
(R):5'- AAGTATGTTGGGTTCTAGTCACAATG -3'
Posted On 2015-09-24