Incidental Mutation 'R4581:Src'
ID343648
Institutional Source Beutler Lab
Gene Symbol Src
Ensembl Gene ENSMUSG00000027646
Gene NameRous sarcoma oncogene
Synonymspp60c-src
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock #R4581 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location157418444-157471862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 157463038 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 175 (N175I)
Ref Sequence ENSEMBL: ENSMUSP00000105155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029175] [ENSMUST00000092576] [ENSMUST00000109529] [ENSMUST00000109531] [ENSMUST00000109533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029175
AA Change: N169I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029175
Gene: ENSMUSG00000027646
AA Change: N169I

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092576
AA Change: N175I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090237
Gene: ENSMUSG00000027646
AA Change: N175I

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109529
AA Change: N175I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105155
Gene: ENSMUSG00000027646
AA Change: N175I

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109531
AA Change: N169I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105157
Gene: ENSMUSG00000027646
AA Change: N169I

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109533
AA Change: N169I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105159
Gene: ENSMUSG00000027646
AA Change: N169I

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129770
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation, failure of tooth eruption, osteopetrosis with lack of secondary bone resorption, and lethality at 3-4 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Src
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Src APN 2 157469503 missense probably damaging 1.00
IGL01320:Src APN 2 157469503 missense probably damaging 1.00
IGL01323:Src APN 2 157469503 missense probably damaging 1.00
IGL01452:Src APN 2 157462983 missense probably damaging 1.00
IGL02618:Src APN 2 157464778 nonsense probably null
R0605:Src UTSW 2 157469921 missense probably damaging 1.00
R1457:Src UTSW 2 157469212 missense probably damaging 1.00
R1471:Src UTSW 2 157457187 nonsense probably null
R1694:Src UTSW 2 157469755 missense possibly damaging 0.95
R2040:Src UTSW 2 157457110 missense probably benign 0.02
R2209:Src UTSW 2 157462790 missense probably benign 0.16
R4112:Src UTSW 2 157463026 missense probably damaging 1.00
R4414:Src UTSW 2 157464653 missense probably damaging 1.00
R4661:Src UTSW 2 157469932 missense probably damaging 1.00
R4781:Src UTSW 2 157467485 missense possibly damaging 0.71
R5504:Src UTSW 2 157464721 missense probably damaging 1.00
R5913:Src UTSW 2 157466030 critical splice donor site probably null
R6166:Src UTSW 2 157468522 missense probably damaging 0.99
R6336:Src UTSW 2 157457155 missense probably benign 0.04
R7707:Src UTSW 2 157464658 missense probably damaging 1.00
R7709:Src UTSW 2 157457244 missense probably benign 0.00
Z1176:Src UTSW 2 157467539 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ACCACTTCTAGTACCGAGTCC -3'
(R):5'- CAGTCTTCCTCAAGTGCCAC -3'

Sequencing Primer
(F):5'- CCTCGTGGGCCCGAGTG -3'
(R):5'- AGTCTTCCTCAAGTGCCACTTTAAC -3'
Posted On2015-09-24