Incidental Mutation 'R4581:Phactr3'
ID343650
Institutional Source Beutler Lab
Gene Symbol Phactr3
Ensembl Gene ENSMUSG00000027525
Gene Namephosphatase and actin regulator 3
Synonyms4930415A02Rik, 1500003N10Rik, scapinin
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4581 (G1)
Quality Score170
Status Not validated
Chromosome2
Chromosomal Location178118975-178338492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 178283172 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 300 (H300P)
Ref Sequence ENSEMBL: ENSMUSP00000104545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103065] [ENSMUST00000103066] [ENSMUST00000108915] [ENSMUST00000108916] [ENSMUST00000108917]
AlphaFold Q8BYK5
Predicted Effect probably damaging
Transcript: ENSMUST00000103065
AA Change: H264P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099354
Gene: ENSMUSG00000027525
AA Change: H264P

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
RPEL 52 77 2.08e0 SMART
low complexity region 187 206 N/A INTRINSIC
RPEL 360 385 5.1e-4 SMART
low complexity region 387 397 N/A INTRINSIC
RPEL 398 423 3.24e-6 SMART
RPEL 436 461 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103066
AA Change: H304P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525
AA Change: H304P

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
RPEL 92 117 2.08e0 SMART
low complexity region 227 246 N/A INTRINSIC
RPEL 400 425 5.1e-4 SMART
low complexity region 427 437 N/A INTRINSIC
RPEL 438 463 3.24e-6 SMART
RPEL 476 501 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108915
AA Change: H305P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104543
Gene: ENSMUSG00000027525
AA Change: H305P

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
RPEL 93 118 2.08e0 SMART
low complexity region 228 247 N/A INTRINSIC
RPEL 401 426 5.1e-4 SMART
low complexity region 428 438 N/A INTRINSIC
RPEL 439 464 3.24e-6 SMART
RPEL 477 502 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108916
AA Change: H300P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525
AA Change: H300P

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 434 459 3.24e-6 SMART
RPEL 472 497 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108917
AA Change: H300P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525
AA Change: H300P

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 436 458 2.74e-4 SMART
RPEL 471 496 9.82e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Phactr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Phactr3 APN 2 178279062 missense probably benign 0.00
IGL01432:Phactr3 APN 2 178283100 missense probably benign 0.05
IGL01580:Phactr3 APN 2 178269504 splice site probably benign
IGL02688:Phactr3 APN 2 178278999 missense probably damaging 0.96
IGL02985:Phactr3 APN 2 178175457 missense probably benign
PIT4151001:Phactr3 UTSW 2 178334068 missense probably damaging 1.00
R1854:Phactr3 UTSW 2 178283147 missense probably damaging 1.00
R2132:Phactr3 UTSW 2 178283966 missense probably benign 0.14
R3110:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3112:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3122:Phactr3 UTSW 2 178331618 missense probably damaging 1.00
R4193:Phactr3 UTSW 2 178283152 missense probably damaging 0.98
R4194:Phactr3 UTSW 2 178283109 missense possibly damaging 0.80
R4243:Phactr3 UTSW 2 178283189 splice site probably null
R4245:Phactr3 UTSW 2 178283189 splice site probably null
R4397:Phactr3 UTSW 2 178175406 intron probably benign
R4433:Phactr3 UTSW 2 178283132 missense probably damaging 1.00
R4772:Phactr3 UTSW 2 178283936 missense probably damaging 1.00
R4830:Phactr3 UTSW 2 178284018 missense probably damaging 0.98
R5045:Phactr3 UTSW 2 178331619 missense probably damaging 1.00
R5442:Phactr3 UTSW 2 178142461 missense probably benign 0.38
R5461:Phactr3 UTSW 2 178278901 missense probably benign
R5816:Phactr3 UTSW 2 178302793 missense probably damaging 1.00
R6276:Phactr3 UTSW 2 178279019 missense probably damaging 0.99
R6668:Phactr3 UTSW 2 178332864 missense probably damaging 1.00
R7144:Phactr3 UTSW 2 178302736 missense probably damaging 1.00
R7340:Phactr3 UTSW 2 178334061 missense probably damaging 1.00
R7798:Phactr3 UTSW 2 178283910 missense probably benign 0.19
R8009:Phactr3 UTSW 2 178332944 missense probably damaging 1.00
R8074:Phactr3 UTSW 2 178302796 missense probably damaging 1.00
R8348:Phactr3 UTSW 2 178256142 missense probably benign 0.03
R8530:Phactr3 UTSW 2 178284026 missense probably damaging 1.00
R9153:Phactr3 UTSW 2 178283946 missense possibly damaging 0.79
Z1176:Phactr3 UTSW 2 178269374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTATTGCTCCACCCCAGGAC -3'
(R):5'- ATCGTGGGGATTTCAGAATCG -3'

Sequencing Primer
(F):5'- GACAAGCTGCGCTCTTCCAAG -3'
(R):5'- CCCCTATGAGAGATCATGCAGG -3'
Posted On2015-09-24