Mutagenetix > Incidental Mutations

Incidental Mutation 'R4581:Adgrd1'

343666

Institutional Source

Beutler Lab

Gene Symbol

Adgrd1

Ensembl Gene

ENSMUSG00000044017

Gene Name

adhesion G protein-coupled receptor D1

Synonyms

E230012M21Rik, Gpr133

MMRRC Submission

041802-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129096750-129204599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 129202531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 863 (A863V)

Ref Sequence

ENSEMBL: ENSMUSP00000121217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]

AlphaFold

Q80T32

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056617
AA Change: A895V

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: A895V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Laminin_G_3	119	273	2.9e-18	PFAM
Pfam:Pentaxin	171	288	2.2e-7	PFAM
GPS	535	585	1.57e-14	SMART
Pfam:Dicty_CAR	590	856	1.2e-8	PFAM
Pfam:7tm_2	592	831	8e-58	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156437
AA Change: A863V

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: A863V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Adgrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Adgrd1	APN	5	129139592	missense	probably benign	0.06
IGL01384:Adgrd1	APN	5	129097209	missense	possibly damaging	0.47
IGL01636:Adgrd1	APN	5	129142452	splice site	probably benign
IGL01916:Adgrd1	APN	5	129132838	missense	probably benign	0.12
IGL01923:Adgrd1	APN	5	129178079	missense	possibly damaging	0.58
IGL02019:Adgrd1	APN	5	129115138	missense	probably benign	0.00
IGL02142:Adgrd1	APN	5	129131584	missense	probably benign
IGL02149:Adgrd1	APN	5	129179261	missense	probably damaging	1.00
IGL02190:Adgrd1	APN	5	129140724	splice site	probably benign
IGL02623:Adgrd1	APN	5	129132745	missense	probably damaging	0.99
IGL02696:Adgrd1	APN	5	129140854	splice site	probably benign
IGL02850:Adgrd1	APN	5	129115055	missense	probably damaging	1.00
IGL02976:Adgrd1	APN	5	129131597	missense	probably benign	0.00
IGL02988:Adgrd1	UTSW	5	129144010	missense	probably benign	0.00
PIT4458001:Adgrd1	UTSW	5	129131577	missense	probably damaging	1.00
R0081:Adgrd1	UTSW	5	129178082	missense	probably damaging	0.99
R0266:Adgrd1	UTSW	5	129139594	missense	probably benign	0.00
R0267:Adgrd1	UTSW	5	129139594	missense	probably benign	0.00
R0464:Adgrd1	UTSW	5	129162650	missense	probably damaging	1.00
R0625:Adgrd1	UTSW	5	129171931	critical splice donor site	probably null
R1288:Adgrd1	UTSW	5	129129007	missense	probably damaging	0.97
R1460:Adgrd1	UTSW	5	129122563	missense	possibly damaging	0.63
R1635:Adgrd1	UTSW	5	129128907	missense	probably damaging	1.00
R1658:Adgrd1	UTSW	5	129178100	missense	probably benign	0.02
R1709:Adgrd1	UTSW	5	129179228	missense	possibly damaging	0.95
R1897:Adgrd1	UTSW	5	129129001	missense	probably benign	0.01
R1976:Adgrd1	UTSW	5	129140797	missense	probably benign	0.06
R2049:Adgrd1	UTSW	5	129115095	missense	probably benign	0.01
R2259:Adgrd1	UTSW	5	129112311	missense	possibly damaging	0.92
R2295:Adgrd1	UTSW	5	129122506	missense	probably benign	0.13
R3076:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R3077:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R3078:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R5024:Adgrd1	UTSW	5	129171895	missense	probably damaging	1.00
R5076:Adgrd1	UTSW	5	129143989	nonsense	probably null
R5227:Adgrd1	UTSW	5	129122583	missense	probably benign	0.00
R5453:Adgrd1	UTSW	5	129179583	missense	probably damaging	0.99
R6349:Adgrd1	UTSW	5	129142539	splice site	probably null
R6953:Adgrd1	UTSW	5	129115078	nonsense	probably null
R7300:Adgrd1	UTSW	5	129097347	critical splice donor site	probably null
R7583:Adgrd1	UTSW	5	129179588	missense	probably benign	0.42
R7622:Adgrd1	UTSW	5	129139624	missense	probably benign	0.27
R8205:Adgrd1	UTSW	5	129115111	missense	possibly damaging	0.94
R8716:Adgrd1	UTSW	5	129188371	missense	possibly damaging	0.94
R8780:Adgrd1	UTSW	5	129097074	start gained	probably benign
R8850:Adgrd1	UTSW	5	129142510	missense	probably benign	0.00
X0067:Adgrd1	UTSW	5	129188352	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCTCTAGTCTGGACCCTTTG -3'
(R):5'- CAGGACGTTCTGCACAGTCATAG -3'

Sequencing Primer
(F):5'- CAGAGCCTTGTGTCTCAGAAG -3'
(R):5'- CAGTCATAGGTAGGGGCCATTATCC -3'

Posted On

2015-09-24