Incidental Mutation 'R4581:Dnaaf5'
ID 343668
Institutional Source Beutler Lab
Gene Symbol Dnaaf5
Ensembl Gene ENSMUSG00000025857
Gene Name dynein, axonemal assembly factor 5
Synonyms Heatr2
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 139150223-139186510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139184685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 502 (D502E)
Ref Sequence ENSEMBL: ENSMUSP00000142924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000196441]
AlphaFold B9EJR8
Predicted Effect probably damaging
Transcript: ENSMUST00000026975
AA Change: D797E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: D797E

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 91 153 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
Pfam:Vac14_Fab1_bd 673 770 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196441
AA Change: D502E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857
AA Change: D502E

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 378 475 4.1e-5 PFAM
Pfam:HEAT 447 477 1.7e-3 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Dnaaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dnaaf5 APN 5 139177946 missense probably benign 0.19
IGL00730:Dnaaf5 APN 5 139151668 critical splice donor site probably null
IGL01468:Dnaaf5 APN 5 139151480 splice site probably null
IGL02106:Dnaaf5 APN 5 139151513 missense probably damaging 1.00
IGL02273:Dnaaf5 APN 5 139177916 nonsense probably null
IGL02514:Dnaaf5 APN 5 139174117 splice site probably benign
IGL02572:Dnaaf5 APN 5 139184629 missense probably benign 0.00
IGL02699:Dnaaf5 APN 5 139153350 splice site probably benign
PIT4142001:Dnaaf5 UTSW 5 139185518 missense possibly damaging 0.91
PIT4283001:Dnaaf5 UTSW 5 139166162 missense probably benign 0.26
R0458:Dnaaf5 UTSW 5 139161878 missense possibly damaging 0.47
R2060:Dnaaf5 UTSW 5 139178003 missense probably damaging 1.00
R2162:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3833:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3944:Dnaaf5 UTSW 5 139152924 start gained probably benign
R4438:Dnaaf5 UTSW 5 139163392 missense probably damaging 1.00
R4534:Dnaaf5 UTSW 5 139151527 nonsense probably null
R4576:Dnaaf5 UTSW 5 139185639 missense probably damaging 0.98
R4715:Dnaaf5 UTSW 5 139178000 missense probably damaging 0.99
R4791:Dnaaf5 UTSW 5 139184650 missense possibly damaging 0.56
R4868:Dnaaf5 UTSW 5 139170186 missense probably benign 0.01
R5011:Dnaaf5 UTSW 5 139163257 missense probably damaging 1.00
R5074:Dnaaf5 UTSW 5 139174207 missense probably damaging 1.00
R5137:Dnaaf5 UTSW 5 139181460 missense probably damaging 1.00
R5215:Dnaaf5 UTSW 5 139161877 missense probably benign 0.00
R5309:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R5312:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R6632:Dnaaf5 UTSW 5 139170333 missense probably benign 0.04
R6863:Dnaaf5 UTSW 5 139151596 missense probably damaging 0.96
R7292:Dnaaf5 UTSW 5 139150317 missense unknown
R7439:Dnaaf5 UTSW 5 139166113 missense probably damaging 1.00
R7571:Dnaaf5 UTSW 5 139170208 missense possibly damaging 0.73
R7679:Dnaaf5 UTSW 5 139150637 missense unknown
R7706:Dnaaf5 UTSW 5 139152841 missense probably damaging 1.00
R7867:Dnaaf5 UTSW 5 139161810 missense probably damaging 1.00
R8191:Dnaaf5 UTSW 5 139181495 missense probably benign 0.06
R8354:Dnaaf5 UTSW 5 139161859 frame shift probably null
R8355:Dnaaf5 UTSW 5 139161859 frame shift probably null
R8990:Dnaaf5 UTSW 5 139170196 missense probably damaging 1.00
R9178:Dnaaf5 UTSW 5 139152897 missense probably damaging 1.00
X0020:Dnaaf5 UTSW 5 139163320 missense probably damaging 0.99
Z1177:Dnaaf5 UTSW 5 139177975 missense probably damaging 1.00
Z1177:Dnaaf5 UTSW 5 139185542 missense probably benign 0.04
Z1177:Dnaaf5 UTSW 5 139185585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCCCACAGAGCTCTTGAAG -3'
(R):5'- CCTGCATCATGCTAAGCTGTTTG -3'

Sequencing Primer
(F):5'- AAGCGCCTAGATGATGTCTC -3'
(R):5'- AGATCGAGGGTATCCAATGTCCTC -3'
Posted On 2015-09-24