Incidental Mutation 'R4581:Tfec'
ID 343669
Institutional Source Beutler Lab
Gene Symbol Tfec
Ensembl Gene ENSMUSG00000029553
Gene Name transcription factor EC
Synonyms Tcfec, bHLHe34, TFEC
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 16833373-16898441 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 16834125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 261 (T261I)
Ref Sequence ENSEMBL: ENSMUSP00000031533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031533] [ENSMUST00000202997]
AlphaFold Q9WTW4
Predicted Effect probably damaging
Transcript: ENSMUST00000031533
AA Change: T261I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031533
Gene: ENSMUSG00000029553
AA Change: T261I

DomainStartEndE-ValueType
HLH 116 169 1.8e-16 SMART
Pfam:DUF3371 196 314 4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201406
Predicted Effect probably benign
Transcript: ENSMUST00000202997
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the micropthalmia (MiT) family of basic helix-loop-helix leucine zipper transcription factors. MiT transcription factors regulate the expression of target genes by binding to E-box recognition sequences as homo- or heterodimers, and play roles in multiple cellular processes including survival, growth and differentiation. The encoded protein is a transcriptional activator of the nonmuscle myosin II heavy chain-A gene, and may also co-regulate target genes in osteoclasts as a heterodimer with micropthalmia-associated transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, normally pigmented, have normal eyes and mast cells, and show no evidence of osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Tfec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Tfec APN 6 16845466 missense probably damaging 0.98
IGL02655:Tfec APN 6 16834309 missense possibly damaging 0.60
R1581:Tfec UTSW 6 16844244 missense probably damaging 1.00
R1824:Tfec UTSW 6 16840468 critical splice donor site probably null
R1897:Tfec UTSW 6 16835308 missense probably damaging 1.00
R2881:Tfec UTSW 6 16835233 missense probably benign
R3932:Tfec UTSW 6 16845459 missense probably damaging 1.00
R4627:Tfec UTSW 6 16840479 missense probably damaging 0.99
R5568:Tfec UTSW 6 16867593 missense possibly damaging 0.69
R5590:Tfec UTSW 6 16834200 missense probably benign 0.09
R6723:Tfec UTSW 6 16835302 missense probably damaging 1.00
R7211:Tfec UTSW 6 16867465 missense probably damaging 1.00
R7510:Tfec UTSW 6 16835233 missense probably benign
R7681:Tfec UTSW 6 16834236 missense probably benign 0.30
R7912:Tfec UTSW 6 16840468 critical splice donor site probably null
R8337:Tfec UTSW 6 16845423 missense possibly damaging 0.82
R8352:Tfec UTSW 6 16844203 missense probably damaging 1.00
R8452:Tfec UTSW 6 16844203 missense probably damaging 1.00
R9134:Tfec UTSW 6 16835327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCGGCTTACAACTCATCAC -3'
(R):5'- TTGGGCATTTGCAGGAACTAG -3'

Sequencing Primer
(F):5'- TCACCATCCTCTGAGCTAAGG -3'
(R):5'- GCACGTGCTCATGGTCTAC -3'
Posted On 2015-09-24