Mutagenetix > Incidental Mutation

Incidental Mutation 'R4581:Trappc11'

343681

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

041802-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47493345 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1084 (M1084K)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061]

AlphaFold

B2RXC1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039061
AA Change: M1084K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: M1084K

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bantu	UTSW	8	47498666	missense	probably benign	0.44
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R4994:Trappc11	UTSW	8	47522441	nonsense	probably null
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98
R9544:Trappc11	UTSW	8	47519678	missense	possibly damaging	0.94
R9709:Trappc11	UTSW	8	47493313	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AATGCCATCACTGCTAGCTTTC -3'
(R):5'- TTTGGAAGGCTGGCTAGAAG -3'

Sequencing Primer
(F):5'- CACTTTCCCTCGGCGAG -3'
(R):5'- GCTAGAAGAGAGCATGCAACTTCAC -3'

Posted On

2015-09-24