Mutagenetix > Incidental Mutation

Incidental Mutation 'R4581:Ddx60'

343682

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

041802-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62023261 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1548 (M1548L)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070631
AA Change: M1547L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: M1547L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093485
AA Change: M1548L

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: M1548L

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136121

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
R9766:Ddx60	UTSW	8	62012278	missense	probably damaging	1.00
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AATACCTCAGTTCAACCAAGAAGTG -3'
(R):5'- CTAGAATGTCAGCCTTCAGAGG -3'

Sequencing Primer
(F):5'- GAAGTGAAGAAAATGCAGCTTTATTG -3'
(R):5'- TGTCAGCCTTCAGAGGTAAATATGG -3'

Posted On

2015-09-24