Incidental Mutation 'R4581:Fanca'
ID343683
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene NameFanconi anemia, complementation group A
Synonyms
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R4581 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123268300-123318576 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 123274338 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000035495] [ENSMUST00000035495] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000001092
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000035495
AA Change: R1129K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: R1129K

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000035495
AA Change: R1129K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: R1129K

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000035495
AA Change: R1129K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: R1129K

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126834
SMART Domains Protein: ENSMUSP00000116732
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155510
SMART Domains Protein: ENSMUSP00000118712
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 54 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211934
Predicted Effect probably null
Transcript: ENSMUST00000213090
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 123305263 missense probably damaging 1.00
IGL02805:Fanca APN 8 123289494 missense probably damaging 0.99
IGL03280:Fanca APN 8 123316459 unclassified probably benign
PIT4402001:Fanca UTSW 8 123313064 missense possibly damaging 0.83
R0114:Fanca UTSW 8 123288491 splice site probably null
R0115:Fanca UTSW 8 123268539 missense probably benign 0.00
R0271:Fanca UTSW 8 123272441 unclassified probably benign
R0330:Fanca UTSW 8 123274172 nonsense probably null
R0345:Fanca UTSW 8 123304813 missense probably damaging 1.00
R0570:Fanca UTSW 8 123306430 missense probably benign 0.01
R0601:Fanca UTSW 8 123308513 missense probably damaging 0.99
R0617:Fanca UTSW 8 123288070 missense probably damaging 0.99
R0639:Fanca UTSW 8 123289359 critical splice donor site probably null
R0943:Fanca UTSW 8 123274186 missense probably damaging 1.00
R1140:Fanca UTSW 8 123313129 splice site probably null
R1364:Fanca UTSW 8 123304281 splice site probably benign
R1366:Fanca UTSW 8 123304281 splice site probably benign
R1367:Fanca UTSW 8 123304281 splice site probably benign
R1368:Fanca UTSW 8 123304281 splice site probably benign
R1969:Fanca UTSW 8 123288064 missense probably benign 0.41
R1992:Fanca UTSW 8 123297812 missense possibly damaging 0.94
R2060:Fanca UTSW 8 123274481 missense probably damaging 1.00
R2174:Fanca UTSW 8 123271270 missense probably benign 0.00
R2261:Fanca UTSW 8 123289359 critical splice donor site probably null
R3957:Fanca UTSW 8 123316363 missense probably benign 0.00
R4062:Fanca UTSW 8 123275172 missense probably benign 0.00
R4153:Fanca UTSW 8 123304878 missense possibly damaging 0.89
R4270:Fanca UTSW 8 123268794 missense probably damaging 1.00
R4424:Fanca UTSW 8 123288793 missense probably benign 0.11
R4639:Fanca UTSW 8 123318150 missense probably damaging 0.98
R4664:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4665:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4666:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4686:Fanca UTSW 8 123268934 splice site probably benign
R4775:Fanca UTSW 8 123296306 missense probably damaging 0.99
R4782:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4799:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4926:Fanca UTSW 8 123303985 missense probably benign 0.05
R4973:Fanca UTSW 8 123308522 missense probably damaging 0.96
R5039:Fanca UTSW 8 123284046 missense probably benign
R5195:Fanca UTSW 8 123303945 intron probably benign
R5590:Fanca UTSW 8 123303963 intron probably benign
R5848:Fanca UTSW 8 123295053 intron probably benign
R5965:Fanca UTSW 8 123316410 missense possibly damaging 0.46
R6224:Fanca UTSW 8 123305281 missense possibly damaging 0.87
R6385:Fanca UTSW 8 123305867 splice site probably null
R6762:Fanca UTSW 8 123271303 missense probably benign 0.26
R6795:Fanca UTSW 8 123318493 missense probably benign 0.02
R6810:Fanca UTSW 8 123286477 missense probably damaging 0.99
R7153:Fanca UTSW 8 123316425 missense probably damaging 1.00
R7170:Fanca UTSW 8 123271206 missense probably damaging 1.00
R7204:Fanca UTSW 8 123286477 missense probably damaging 0.98
R7366:Fanca UTSW 8 123281213 missense probably benign 0.08
R7599:Fanca UTSW 8 123271260 missense probably benign
R7639:Fanca UTSW 8 123291395 critical splice donor site probably null
R7650:Fanca UTSW 8 123268564 splice site probably null
R8066:Fanca UTSW 8 123303940 missense unknown
R8247:Fanca UTSW 8 123283955 unclassified probably benign
R8312:Fanca UTSW 8 123269810 intron probably benign
R8327:Fanca UTSW 8 123313245 nonsense probably null
R8719:Fanca UTSW 8 123288128 missense probably benign 0.00
R8826:Fanca UTSW 8 123268470 missense probably benign 0.07
V7732:Fanca UTSW 8 123304281 splice site probably benign
X0025:Fanca UTSW 8 123276548 intron probably benign
X0062:Fanca UTSW 8 123304852 missense possibly damaging 0.95
Z1177:Fanca UTSW 8 123312629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGACACTTAGTCTGGCATTC -3'
(R):5'- TGTCTTCACCACGATGCACC -3'

Sequencing Primer
(F):5'- CTGGCATTCTGTCAGTGTCTG -3'
(R):5'- GGCCGGACAACCTATCTCC -3'
Posted On2015-09-24