Incidental Mutation 'R4581:Ascc3'
ID 343685
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Name activating signal cointegrator 1 complex subunit 3
Synonyms Helic1, B630009I04Rik, ASC1p200
MMRRC Submission 041802-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 50468756-50727300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50587121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 991 (I991T)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
AlphaFold E9PZJ8
Predicted Effect probably damaging
Transcript: ENSMUST00000035606
AA Change: I991T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: I991T

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,828 (GRCm39) S712R possibly damaging Het
4933427I04Rik A G 4: 123,754,146 (GRCm39) D20G possibly damaging Het
Abca7 A G 10: 79,842,402 (GRCm39) D1112G probably benign Het
Actc1 G T 2: 113,880,089 (GRCm39) H175N possibly damaging Het
Adgrd1 C T 5: 129,279,595 (GRCm39) A863V possibly damaging Het
Ankrd17 T C 5: 90,430,979 (GRCm39) D935G possibly damaging Het
Ankrd7 T A 6: 18,868,020 (GRCm39) N95K probably damaging Het
Arhgef4 G A 1: 34,771,205 (GRCm39) E1171K possibly damaging Het
Cacna1s T A 1: 135,998,708 (GRCm39) probably null Het
Camk1d A T 2: 5,359,515 (GRCm39) V177E probably benign Het
Cdh18 T A 15: 23,226,869 (GRCm39) I110N probably damaging Het
Cenpe A G 3: 134,952,761 (GRCm39) K1484E probably benign Het
Cep68 A G 11: 20,189,333 (GRCm39) S560P probably benign Het
Cog3 G T 14: 75,970,391 (GRCm39) T352K probably benign Het
Cox6a2 A G 7: 127,805,152 (GRCm39) S44P possibly damaging Het
Cplane1 C A 15: 8,201,282 (GRCm39) P20T possibly damaging Het
Csmd2 T C 4: 128,262,881 (GRCm39) V689A probably benign Het
Ddx60 A T 8: 62,476,295 (GRCm39) M1548L possibly damaging Het
Dennd5b G T 6: 148,918,482 (GRCm39) silent Het
Dlgap2 T C 8: 14,896,679 (GRCm39) Y1052H probably damaging Het
Dnaaf5 T A 5: 139,170,440 (GRCm39) D502E probably damaging Het
Efhb C A 17: 53,733,303 (GRCm39) A523S probably damaging Het
Epha8 C T 4: 136,660,775 (GRCm39) V648M probably damaging Het
Fanca C T 8: 124,001,077 (GRCm39) probably null Het
Fbxw7 G A 3: 84,874,852 (GRCm39) E205K probably benign Het
Fer1l6 C T 15: 58,512,075 (GRCm39) T1514I probably damaging Het
Gm12886 T C 4: 121,273,880 (GRCm39) E112G probably damaging Het
Gm7535 T C 17: 18,131,345 (GRCm39) probably benign Het
Irf2bp2 T A 8: 127,317,994 (GRCm39) Q524L probably damaging Het
Itih4 A G 14: 30,622,925 (GRCm39) D864G probably benign Het
Kdm4c T G 4: 74,275,576 (GRCm39) probably null Het
Ltn1 A T 16: 87,198,912 (GRCm39) probably null Het
Mafa G T 15: 75,619,585 (GRCm39) P63T unknown Het
Mars2 T A 1: 55,277,021 (GRCm39) L208H probably damaging Het
Myom2 A G 8: 15,156,459 (GRCm39) I769V probably benign Het
Nyap1 A G 5: 137,734,284 (GRCm39) S250P probably damaging Het
Or8k35 A T 2: 86,424,572 (GRCm39) M200K probably benign Het
Osmr C T 15: 6,872,375 (GRCm39) V240I probably benign Het
Pcdhga3 A G 18: 37,809,934 (GRCm39) T796A probably benign Het
Pclo T C 5: 14,725,519 (GRCm39) V1459A unknown Het
Phactr3 A C 2: 177,924,965 (GRCm39) H300P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plcd4 T A 1: 74,587,383 (GRCm39) W48R probably damaging Het
Prdm16 A G 4: 154,407,810 (GRCm39) S1140P probably damaging Het
Rarg A C 15: 102,160,986 (GRCm39) S18A possibly damaging Het
Rfx4 T A 10: 84,680,164 (GRCm39) S114T possibly damaging Het
Sec14l4 G A 11: 3,993,375 (GRCm39) probably null Het
Six1 T G 12: 73,092,708 (GRCm39) T165P probably benign Het
Skint4 T C 4: 111,944,239 (GRCm39) L17P probably damaging Het
Slc25a23 T A 17: 57,359,740 (GRCm39) Y337F probably damaging Het
Slc9a3 A G 13: 74,312,284 (GRCm39) Y627C probably damaging Het
Smu1 A C 4: 40,737,401 (GRCm39) probably null Het
Spryd3 A G 15: 102,038,799 (GRCm39) S141P probably damaging Het
Src A T 2: 157,304,958 (GRCm39) N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,157,482 (GRCm39) probably benign Het
Stc2 A G 11: 31,315,326 (GRCm39) probably null Het
Taf6l T C 19: 8,755,572 (GRCm39) D261G probably damaging Het
Tal1 T G 4: 114,921,919 (GRCm39) V167G probably damaging Het
Tfec G A 6: 16,834,124 (GRCm39) T261I probably damaging Het
Tgfb1 G T 7: 25,396,655 (GRCm39) S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 (GRCm39) V636E probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trappc11 A T 8: 47,946,380 (GRCm39) M1084K probably damaging Het
Trem3 A C 17: 48,556,639 (GRCm39) T37P possibly damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Urb1 T C 16: 90,585,034 (GRCm39) D529G probably benign Het
Vmn2r8 T A 5: 108,949,570 (GRCm39) T426S probably benign Het
Yipf4 T C 17: 74,806,089 (GRCm39) Y243H probably benign Het
Zfp574 T A 7: 24,780,738 (GRCm39) C587S probably damaging Het
Zfp93 C A 7: 23,975,093 (GRCm39) H359Q probably damaging Het
Znfx1 T C 2: 166,892,236 (GRCm39) E660G probably damaging Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50,590,531 (GRCm39) missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50,576,039 (GRCm39) nonsense probably null
IGL00897:Ascc3 APN 10 50,604,187 (GRCm39) missense probably benign 0.01
IGL01077:Ascc3 APN 10 50,525,413 (GRCm39) splice site probably benign
IGL01124:Ascc3 APN 10 50,608,569 (GRCm39) missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50,626,618 (GRCm39) missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50,566,235 (GRCm39) missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50,726,623 (GRCm39) nonsense probably null
IGL02247:Ascc3 APN 10 50,526,686 (GRCm39) missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50,604,250 (GRCm39) nonsense probably null
IGL02428:Ascc3 APN 10 50,721,791 (GRCm39) nonsense probably null
IGL02432:Ascc3 APN 10 50,576,589 (GRCm39) missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50,576,695 (GRCm39) missense probably benign 0.00
IGL02640:Ascc3 APN 10 50,643,470 (GRCm39) missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50,536,769 (GRCm39) missense probably benign 0.01
IGL03144:Ascc3 APN 10 50,643,539 (GRCm39) missense probably benign 0.16
IGL03161:Ascc3 APN 10 50,494,168 (GRCm39) missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50,699,949 (GRCm39) missense possibly damaging 0.89
algorithm UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
heuristic UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
network UTSW 10 50,630,175 (GRCm39) missense possibly damaging 0.53
R0045:Ascc3 UTSW 10 50,594,498 (GRCm39) nonsense probably null
R0045:Ascc3 UTSW 10 50,594,498 (GRCm39) nonsense probably null
R0131:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50,611,425 (GRCm39) missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50,484,089 (GRCm39) missense probably benign 0.31
R0165:Ascc3 UTSW 10 50,718,223 (GRCm39) splice site probably null
R0255:Ascc3 UTSW 10 50,521,154 (GRCm39) missense probably benign 0.00
R0310:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0314:Ascc3 UTSW 10 50,514,095 (GRCm39) missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50,625,051 (GRCm39) splice site probably benign
R0418:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0419:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0421:Ascc3 UTSW 10 50,625,022 (GRCm39) missense probably benign 0.02
R0480:Ascc3 UTSW 10 50,611,348 (GRCm39) missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50,721,762 (GRCm39) missense probably benign 0.17
R0833:Ascc3 UTSW 10 50,721,762 (GRCm39) missense probably benign 0.17
R1231:Ascc3 UTSW 10 50,699,756 (GRCm39) missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50,518,615 (GRCm39) splice site probably benign
R1302:Ascc3 UTSW 10 50,480,890 (GRCm39) start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50,594,472 (GRCm39) missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50,576,586 (GRCm39) missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50,566,257 (GRCm39) missense probably benign 0.00
R1855:Ascc3 UTSW 10 50,494,018 (GRCm39) missense probably benign 0.01
R1953:Ascc3 UTSW 10 50,721,726 (GRCm39) missense probably benign
R1976:Ascc3 UTSW 10 50,525,262 (GRCm39) missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50,493,838 (GRCm39) missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50,525,908 (GRCm39) missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50,566,307 (GRCm39) missense probably benign 0.00
R2040:Ascc3 UTSW 10 50,604,227 (GRCm39) missense probably benign
R2043:Ascc3 UTSW 10 50,576,616 (GRCm39) missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50,597,935 (GRCm39) missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50,630,148 (GRCm39) missense probably benign 0.07
R2310:Ascc3 UTSW 10 50,624,988 (GRCm39) missense probably benign 0.15
R2405:Ascc3 UTSW 10 50,607,774 (GRCm39) missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50,494,297 (GRCm39) missense probably benign 0.14
R3410:Ascc3 UTSW 10 50,576,196 (GRCm39) missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50,494,281 (GRCm39) missense probably benign 0.00
R3771:Ascc3 UTSW 10 50,596,814 (GRCm39) splice site probably benign
R3783:Ascc3 UTSW 10 50,604,350 (GRCm39) missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50,718,289 (GRCm39) missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50,597,981 (GRCm39) missense probably benign 0.14
R4509:Ascc3 UTSW 10 50,718,339 (GRCm39) missense probably benign 0.00
R4520:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4521:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4522:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4524:Ascc3 UTSW 10 50,536,766 (GRCm39) missense probably benign
R4701:Ascc3 UTSW 10 50,596,760 (GRCm39) missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50,535,110 (GRCm39) missense probably benign 0.02
R4768:Ascc3 UTSW 10 50,576,595 (GRCm39) missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50,589,329 (GRCm39) missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50,625,227 (GRCm39) missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50,699,894 (GRCm39) missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50,699,744 (GRCm39) missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50,514,059 (GRCm39) missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50,592,757 (GRCm39) missense probably benign 0.00
R5302:Ascc3 UTSW 10 50,583,873 (GRCm39) missense probably benign 0.09
R5436:Ascc3 UTSW 10 50,535,079 (GRCm39) missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50,725,679 (GRCm39) missense probably benign 0.06
R5474:Ascc3 UTSW 10 50,725,634 (GRCm39) missense probably benign 0.25
R5744:Ascc3 UTSW 10 50,586,977 (GRCm39) missense probably benign
R5781:Ascc3 UTSW 10 50,514,074 (GRCm39) missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50,587,049 (GRCm39) missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R5868:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R5869:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6031:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6031:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6032:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6032:Ascc3 UTSW 10 50,718,279 (GRCm39) nonsense probably null
R6109:Ascc3 UTSW 10 50,525,343 (GRCm39) missense probably benign 0.37
R6122:Ascc3 UTSW 10 50,494,021 (GRCm39) missense probably benign
R6128:Ascc3 UTSW 10 50,526,734 (GRCm39) missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50,596,769 (GRCm39) missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50,576,081 (GRCm39) missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50,576,081 (GRCm39) missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50,721,676 (GRCm39) missense probably benign 0.09
R6472:Ascc3 UTSW 10 50,596,783 (GRCm39) missense probably benign 0.03
R6474:Ascc3 UTSW 10 50,624,932 (GRCm39) missense probably benign 0.01
R6480:Ascc3 UTSW 10 50,587,049 (GRCm39) missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50,718,273 (GRCm39) missense probably benign 0.05
R6572:Ascc3 UTSW 10 50,566,343 (GRCm39) nonsense probably null
R6585:Ascc3 UTSW 10 50,718,273 (GRCm39) missense probably benign 0.05
R6656:Ascc3 UTSW 10 50,526,021 (GRCm39) nonsense probably null
R6669:Ascc3 UTSW 10 50,716,469 (GRCm39) missense probably benign
R6675:Ascc3 UTSW 10 50,626,659 (GRCm39) nonsense probably null
R6790:Ascc3 UTSW 10 50,521,808 (GRCm39) missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50,625,158 (GRCm39) missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50,725,742 (GRCm39) missense probably null 0.51
R6919:Ascc3 UTSW 10 50,521,849 (GRCm39) nonsense probably null
R6936:Ascc3 UTSW 10 50,606,057 (GRCm39) missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50,521,762 (GRCm39) missense probably benign 0.00
R6957:Ascc3 UTSW 10 50,604,278 (GRCm39) missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50,592,725 (GRCm39) missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50,716,446 (GRCm39) missense probably benign 0.43
R7358:Ascc3 UTSW 10 50,590,448 (GRCm39) nonsense probably null
R7479:Ascc3 UTSW 10 50,525,895 (GRCm39) missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50,721,796 (GRCm39) missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50,604,393 (GRCm39) missense probably benign 0.04
R8021:Ascc3 UTSW 10 50,607,744 (GRCm39) missense probably benign 0.02
R8134:Ascc3 UTSW 10 50,643,554 (GRCm39) missense probably benign 0.02
R8252:Ascc3 UTSW 10 50,518,706 (GRCm39) missense probably benign
R8348:Ascc3 UTSW 10 50,494,173 (GRCm39) missense probably benign
R8351:Ascc3 UTSW 10 50,725,693 (GRCm39) missense probably benign
R8356:Ascc3 UTSW 10 50,526,003 (GRCm39) missense probably benign 0.38
R8362:Ascc3 UTSW 10 50,518,692 (GRCm39) missense possibly damaging 0.93
R8395:Ascc3 UTSW 10 50,525,400 (GRCm39) missense possibly damaging 0.93
R8448:Ascc3 UTSW 10 50,494,173 (GRCm39) missense probably benign
R8957:Ascc3 UTSW 10 50,576,208 (GRCm39) missense probably damaging 1.00
R9004:Ascc3 UTSW 10 50,718,276 (GRCm39) missense probably benign
R9133:Ascc3 UTSW 10 50,630,175 (GRCm39) missense possibly damaging 0.53
R9200:Ascc3 UTSW 10 50,521,787 (GRCm39) missense possibly damaging 0.55
R9328:Ascc3 UTSW 10 50,535,015 (GRCm39) missense probably damaging 1.00
R9377:Ascc3 UTSW 10 50,608,858 (GRCm39) missense possibly damaging 0.62
R9412:Ascc3 UTSW 10 50,525,230 (GRCm39) missense probably benign 0.00
R9576:Ascc3 UTSW 10 50,494,254 (GRCm39) missense possibly damaging 0.71
R9796:Ascc3 UTSW 10 50,608,801 (GRCm39) nonsense probably null
X0021:Ascc3 UTSW 10 50,576,686 (GRCm39) missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50,526,692 (GRCm39) missense probably benign 0.00
X0026:Ascc3 UTSW 10 50,608,574 (GRCm39) missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50,594,517 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACAAAGTTAGCAAAAGCGTG -3'
(R):5'- GGCATGGAACCCAGACTATTTAAAATC -3'

Sequencing Primer
(F):5'- AGTTAGCAAAAGCGTGTGTTATAG -3'
(R):5'- TCAGCATATTCTGAAGACTAG -3'
Posted On 2015-09-24