Incidental Mutation 'R4581:Sec14l4'
ID 343688
Institutional Source Beutler Lab
Gene Symbol Sec14l4
Ensembl Gene ENSMUSG00000019368
Gene Name SEC14-like lipid binding 4
Synonyms
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 4031462-4048024 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 4043375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019512]
AlphaFold Q8R0F9
Predicted Effect probably null
Transcript: ENSMUST00000019512
SMART Domains Protein: ENSMUSP00000019512
Gene: ENSMUSG00000019368

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.89e-6 SMART
SEC14 76 246 7.7e-57 SMART
Blast:SEC14 257 338 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137324
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Sec14l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02581:Sec14l4 APN 11 4039941 missense possibly damaging 0.49
R0308:Sec14l4 UTSW 11 4041726 splice site probably benign
R0538:Sec14l4 UTSW 11 4040018 missense probably benign
R2327:Sec14l4 UTSW 11 4040041 missense probably benign 0.01
R2409:Sec14l4 UTSW 11 4040048 missense probably benign 0.18
R2473:Sec14l4 UTSW 11 4043359 missense probably benign 0.28
R4684:Sec14l4 UTSW 11 4035200 critical splice donor site probably null
R5530:Sec14l4 UTSW 11 4046342 makesense probably null
R5977:Sec14l4 UTSW 11 4040055 missense possibly damaging 0.89
R6057:Sec14l4 UTSW 11 4035142 missense possibly damaging 0.95
R7664:Sec14l4 UTSW 11 4044178 nonsense probably null
R8465:Sec14l4 UTSW 11 4043948 missense probably damaging 1.00
R9228:Sec14l4 UTSW 11 4039977 missense probably damaging 1.00
X0026:Sec14l4 UTSW 11 4040100 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCAGAATCCAGACCTGAG -3'
(R):5'- TTGCTCCCCTGAGAGTCTACAC -3'

Sequencing Primer
(F):5'- AGACCTGAGCACCTCCTG -3'
(R):5'- ACACACATGAGCTTGCTTTCTGG -3'
Posted On 2015-09-24