Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Tep1'

34369

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

038352-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0058 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50834065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2041 (V2041A)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000227526]

AlphaFold

P97499

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006444
AA Change: V2041A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: V2041A

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227228

Predicted Effect

probably benign
Transcript: ENSMUST00000227526

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228562

Meta Mutation Damage Score

0.7508

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc15a2	A	G	16: 36,754,547	I531T	probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
R0240_Tep1_347	UTSW	14	50863029	splice site	probably benign
R0972_Tep1_893	UTSW	14	50824296	unclassified	probably benign
R1686_Tep1_375	UTSW	14	50836788	missense	probably benign	0.12
R7232_Tep1_671	UTSW	14	50844332	missense	unknown
R8009_Tep1_822	UTSW	14	50824230	missense	possibly damaging	0.93
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
R8475:Tep1	UTSW	14	50841255	missense	probably damaging	1.00
R8695:Tep1	UTSW	14	50845437	missense	possibly damaging	0.85
R8726:Tep1	UTSW	14	50847623	missense	probably damaging	0.98
R8812:Tep1	UTSW	14	50837132	missense	probably damaging	0.98
R9152:Tep1	UTSW	14	50866705	missense	probably benign	0.14
R9269:Tep1	UTSW	14	50844309	missense	probably damaging	0.98
R9299:Tep1	UTSW	14	50844531	splice site	probably benign
R9365:Tep1	UTSW	14	50827140	missense	probably damaging	1.00
R9398:Tep1	UTSW	14	50828972	missense	possibly damaging	0.85
R9408:Tep1	UTSW	14	50837180	missense	possibly damaging	0.85
R9445:Tep1	UTSW	14	50845510	missense	possibly damaging	0.95
R9487:Tep1	UTSW	14	50829230	missense	possibly damaging	0.93
R9555:Tep1	UTSW	14	50868431	missense	possibly damaging	0.52
R9597:Tep1	UTSW	14	50863008	missense	probably damaging	0.99
R9715:Tep1	UTSW	14	50844302	missense
R9732:Tep1	UTSW	14	50850705	missense	probably benign	0.33
R9777:Tep1	UTSW	14	50838986	nonsense	probably null
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCAGGAATCTAGGACCAGAGAGGC -3'
(R):5'- TGGTGGGCAGTTATACACACGGAG -3'

Sequencing Primer
(F):5'- ATAGGGTTGCATCTTCTGCATC -3'
(R):5'- TGAGTTCCGCCATGCAGAAG -3'

Posted On

2013-05-09