Incidental Mutation 'R4581:Stc2'
ID 343690
Institutional Source Beutler Lab
Gene Symbol Stc2
Ensembl Gene ENSMUSG00000020303
Gene Name stanniocalcin 2
Synonyms Stc2l, mustc2
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 31357307-31370074 bp(-) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to G at 31365326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020546]
AlphaFold O88452
Predicted Effect probably null
Transcript: ENSMUST00000020546
SMART Domains Protein: ENSMUSP00000020546
Gene: ENSMUSG00000020303

DomainStartEndE-ValueType
Pfam:Stanniocalcin 12 215 1.4e-94 PFAM
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152094
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are 10-15% larger and grow at a faster rate than wild-type controls from 4 weeks onward. The increased body weight results from an increase in the weight of most major organs, with the exception of testis. Mean alkaline phosphatase levels are 144% of wild-type levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Stc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Stc2 APN 11 31367875 splice site probably benign
IGL03330:Stc2 APN 11 31369804 missense probably benign 0.01
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0016:Stc2 UTSW 11 31360177 missense probably benign 0.00
R0025:Stc2 UTSW 11 31365559 splice site probably null
R1510:Stc2 UTSW 11 31365418 nonsense probably null
R6106:Stc2 UTSW 11 31360392 missense probably benign
R6252:Stc2 UTSW 11 31360346 missense probably damaging 0.98
R6675:Stc2 UTSW 11 31360307 missense probably benign
R6797:Stc2 UTSW 11 31365351 nonsense probably null
R7192:Stc2 UTSW 11 31369872 start gained probably benign
R7545:Stc2 UTSW 11 31367799 missense probably damaging 1.00
R7570:Stc2 UTSW 11 31367798 missense probably damaging 1.00
R7846:Stc2 UTSW 11 31365413 missense probably benign 0.13
R8057:Stc2 UTSW 11 31367806 nonsense probably null
R8273:Stc2 UTSW 11 31369777 missense possibly damaging 0.80
R9146:Stc2 UTSW 11 31367847 missense probably damaging 0.98
R9374:Stc2 UTSW 11 31360332 missense probably benign 0.00
Z1176:Stc2 UTSW 11 31360415 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACCAGTTGGGACTTGGCTAG -3'
(R):5'- TGCGTCATAAATTTGGCTGCATC -3'

Sequencing Primer
(F):5'- TTGTGGGAATTTCAAATCTGATGATC -3'
(R):5'- GCATCAGCAGGAAGTGTCC -3'
Posted On 2015-09-24