Incidental Mutation 'R4581:Six1'
ID 343692
Institutional Source Beutler Lab
Gene Symbol Six1
Ensembl Gene ENSMUSG00000051367
Gene Name sine oculis-related homeobox 1
Synonyms
MMRRC Submission 041802-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 73040015-73053887 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 73045934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 165 (T165P)
Ref Sequence ENSEMBL: ENSMUSP00000059026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050029]
AlphaFold Q62231
Predicted Effect probably benign
Transcript: ENSMUST00000050029
AA Change: T165P

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059026
Gene: ENSMUSG00000051367
AA Change: T165P

DomainStartEndE-ValueType
Pfam:SIX1_SD 9 119 5e-52 PFAM
HOX 125 186 1.32e-17 SMART
low complexity region 214 226 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176310
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 14 and is thought to be involved in limb development. Defects in this gene are a cause of autosomal dominant deafness type 23 (DFNA23) and branchiootic syndrome type 3 (BOS3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes perinatal lethality associated with severe muscle hypoplasia, rib defects, absence of kidneys and thymus, craniofacial anomalies, as well as defects in neurogenesis and ear, nasal, and gland development. Heterozygotes may show variable hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Six1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03177:Six1 APN 12 73043740 missense possibly damaging 0.68
BB003:Six1 UTSW 12 73043809 missense probably benign
BB013:Six1 UTSW 12 73043809 missense probably benign
R0387:Six1 UTSW 12 73046041 missense probably damaging 1.00
R5677:Six1 UTSW 12 73046284 missense possibly damaging 0.84
R7926:Six1 UTSW 12 73043809 missense probably benign
R8097:Six1 UTSW 12 73043750 missense possibly damaging 0.94
R9405:Six1 UTSW 12 73046321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGAACCTTCACAGCAGCG -3'
(R):5'- TATCGGGTGCGCCGAAAATTC -3'

Sequencing Primer
(F):5'- TTCACAGCAGCGTCGCC -3'
(R):5'- TGCGCCGAAAATTCCCGTTG -3'
Posted On 2015-09-24