Incidental Mutation 'R4581:Top2b'
ID 343694
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
MMRRC Submission 041802-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.924) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 16409189 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 777 (I777M)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
AlphaFold Q64511
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160501
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.8018 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,828 (GRCm39) S712R possibly damaging Het
4933427I04Rik A G 4: 123,754,146 (GRCm39) D20G possibly damaging Het
Abca7 A G 10: 79,842,402 (GRCm39) D1112G probably benign Het
Actc1 G T 2: 113,880,089 (GRCm39) H175N possibly damaging Het
Adgrd1 C T 5: 129,279,595 (GRCm39) A863V possibly damaging Het
Ankrd17 T C 5: 90,430,979 (GRCm39) D935G possibly damaging Het
Ankrd7 T A 6: 18,868,020 (GRCm39) N95K probably damaging Het
Arhgef4 G A 1: 34,771,205 (GRCm39) E1171K possibly damaging Het
Ascc3 T C 10: 50,587,121 (GRCm39) I991T probably damaging Het
Cacna1s T A 1: 135,998,708 (GRCm39) probably null Het
Camk1d A T 2: 5,359,515 (GRCm39) V177E probably benign Het
Cdh18 T A 15: 23,226,869 (GRCm39) I110N probably damaging Het
Cenpe A G 3: 134,952,761 (GRCm39) K1484E probably benign Het
Cep68 A G 11: 20,189,333 (GRCm39) S560P probably benign Het
Cog3 G T 14: 75,970,391 (GRCm39) T352K probably benign Het
Cox6a2 A G 7: 127,805,152 (GRCm39) S44P possibly damaging Het
Cplane1 C A 15: 8,201,282 (GRCm39) P20T possibly damaging Het
Csmd2 T C 4: 128,262,881 (GRCm39) V689A probably benign Het
Ddx60 A T 8: 62,476,295 (GRCm39) M1548L possibly damaging Het
Dennd5b G T 6: 148,918,482 (GRCm39) silent Het
Dlgap2 T C 8: 14,896,679 (GRCm39) Y1052H probably damaging Het
Dnaaf5 T A 5: 139,170,440 (GRCm39) D502E probably damaging Het
Efhb C A 17: 53,733,303 (GRCm39) A523S probably damaging Het
Epha8 C T 4: 136,660,775 (GRCm39) V648M probably damaging Het
Fanca C T 8: 124,001,077 (GRCm39) probably null Het
Fbxw7 G A 3: 84,874,852 (GRCm39) E205K probably benign Het
Fer1l6 C T 15: 58,512,075 (GRCm39) T1514I probably damaging Het
Gm12886 T C 4: 121,273,880 (GRCm39) E112G probably damaging Het
Gm7535 T C 17: 18,131,345 (GRCm39) probably benign Het
Irf2bp2 T A 8: 127,317,994 (GRCm39) Q524L probably damaging Het
Itih4 A G 14: 30,622,925 (GRCm39) D864G probably benign Het
Kdm4c T G 4: 74,275,576 (GRCm39) probably null Het
Ltn1 A T 16: 87,198,912 (GRCm39) probably null Het
Mafa G T 15: 75,619,585 (GRCm39) P63T unknown Het
Mars2 T A 1: 55,277,021 (GRCm39) L208H probably damaging Het
Myom2 A G 8: 15,156,459 (GRCm39) I769V probably benign Het
Nyap1 A G 5: 137,734,284 (GRCm39) S250P probably damaging Het
Or8k35 A T 2: 86,424,572 (GRCm39) M200K probably benign Het
Osmr C T 15: 6,872,375 (GRCm39) V240I probably benign Het
Pcdhga3 A G 18: 37,809,934 (GRCm39) T796A probably benign Het
Pclo T C 5: 14,725,519 (GRCm39) V1459A unknown Het
Phactr3 A C 2: 177,924,965 (GRCm39) H300P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plcd4 T A 1: 74,587,383 (GRCm39) W48R probably damaging Het
Prdm16 A G 4: 154,407,810 (GRCm39) S1140P probably damaging Het
Rarg A C 15: 102,160,986 (GRCm39) S18A possibly damaging Het
Rfx4 T A 10: 84,680,164 (GRCm39) S114T possibly damaging Het
Sec14l4 G A 11: 3,993,375 (GRCm39) probably null Het
Six1 T G 12: 73,092,708 (GRCm39) T165P probably benign Het
Skint4 T C 4: 111,944,239 (GRCm39) L17P probably damaging Het
Slc25a23 T A 17: 57,359,740 (GRCm39) Y337F probably damaging Het
Slc9a3 A G 13: 74,312,284 (GRCm39) Y627C probably damaging Het
Smu1 A C 4: 40,737,401 (GRCm39) probably null Het
Spryd3 A G 15: 102,038,799 (GRCm39) S141P probably damaging Het
Src A T 2: 157,304,958 (GRCm39) N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,157,482 (GRCm39) probably benign Het
Stc2 A G 11: 31,315,326 (GRCm39) probably null Het
Taf6l T C 19: 8,755,572 (GRCm39) D261G probably damaging Het
Tal1 T G 4: 114,921,919 (GRCm39) V167G probably damaging Het
Tfec G A 6: 16,834,124 (GRCm39) T261I probably damaging Het
Tgfb1 G T 7: 25,396,655 (GRCm39) S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 (GRCm39) V636E probably damaging Het
Trappc11 A T 8: 47,946,380 (GRCm39) M1084K probably damaging Het
Trem3 A C 17: 48,556,639 (GRCm39) T37P possibly damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Urb1 T C 16: 90,585,034 (GRCm39) D529G probably benign Het
Vmn2r8 T A 5: 108,949,570 (GRCm39) T426S probably benign Het
Yipf4 T C 17: 74,806,089 (GRCm39) Y243H probably benign Het
Zfp574 T A 7: 24,780,738 (GRCm39) C587S probably damaging Het
Zfp93 C A 7: 23,975,093 (GRCm39) H359Q probably damaging Het
Znfx1 T C 2: 166,892,236 (GRCm39) E660G probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R1987:Top2b UTSW 14 16,398,916 (GRCm38) missense probably damaging 0.99
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3707:Top2b UTSW 14 16,388,447 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3812:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4698:Top2b UTSW 14 16,387,331 (GRCm38) nonsense probably null
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6512:Top2b UTSW 14 16,409,854 (GRCm38) missense possibly damaging 0.94
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7562:Top2b UTSW 14 16,412,946 (GRCm38) missense probably benign 0.04
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCACCATGGAGAAGTAAGC -3'
(R):5'- TGAAGTACTCTCCCTGAGCAG -3'

Sequencing Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'
Posted On 2015-09-24