Incidental Mutation 'R4581:Itih4'
ID 343695
Institutional Source Beutler Lab
Gene Symbol Itih4
Ensembl Gene ENSMUSG00000021922
Gene Name inter alpha-trypsin inhibitor, heavy chain 4
Synonyms Itih-4
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 30886476-30902353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30900968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 864 (D864G)
Ref Sequence ENSEMBL: ENSMUSP00000112798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006703] [ENSMUST00000078490] [ENSMUST00000120269] [ENSMUST00000168782]
AlphaFold A6X935
Predicted Effect probably benign
Transcript: ENSMUST00000006703
AA Change: D824G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006703
Gene: ENSMUSG00000021922
AA Change: D824G

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 781 941 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078490
AA Change: D863G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077580
Gene: ENSMUSG00000021922
AA Change: D863G

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 777 941 2.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120269
AA Change: D864G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112798
Gene: ENSMUSG00000021922
AA Change: D864G

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 738 902 6.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134988
Predicted Effect probably benign
Transcript: ENSMUST00000168782
AA Change: D847G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125920
Gene: ENSMUSG00000021922
AA Change: D847G

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 761 925 2.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227899
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors with diverse functions as anti-apoptotic and matrix stabilizing molecules during development. This gene is predominantly expressed in the liver and the encoded protein was found to be a plasma kallikrein-sensitive glycoprotein. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal. Surprisingly, IL-6/STAT3 signaling is significantly suppressed in mutant liver tissues but hepatocytes remain well differentiated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rarg A C 15: 102,252,551 S18A possibly damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Itih4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itih4 APN 14 30895469 missense probably damaging 0.97
IGL00776:Itih4 APN 14 30889604 missense probably benign 0.03
IGL01309:Itih4 APN 14 30891749 missense probably damaging 1.00
IGL01433:Itih4 APN 14 30895448 missense probably benign 0.01
IGL01598:Itih4 APN 14 30887817 missense possibly damaging 0.92
IGL02332:Itih4 APN 14 30887860 missense probably damaging 1.00
IGL03075:Itih4 APN 14 30892283 missense probably benign 0.02
IGL03304:Itih4 APN 14 30898049 missense probably damaging 0.98
IGL03353:Itih4 APN 14 30887844 missense probably damaging 1.00
IGL03396:Itih4 APN 14 30887949 missense probably damaging 1.00
PIT4453001:Itih4 UTSW 14 30901170 missense probably benign 0.29
R0304:Itih4 UTSW 14 30890094 splice site probably null
R0477:Itih4 UTSW 14 30889674 missense probably damaging 1.00
R0783:Itih4 UTSW 14 30895423 missense possibly damaging 0.84
R0882:Itih4 UTSW 14 30892274 missense probably damaging 1.00
R1118:Itih4 UTSW 14 30896167 splice site probably benign
R1126:Itih4 UTSW 14 30889961 critical splice donor site probably null
R1238:Itih4 UTSW 14 30887949 missense probably damaging 1.00
R1456:Itih4 UTSW 14 30892653 missense probably benign 0.31
R1573:Itih4 UTSW 14 30897547 missense probably benign 0.00
R1695:Itih4 UTSW 14 30891499 critical splice donor site probably null
R2085:Itih4 UTSW 14 30892323 missense possibly damaging 0.91
R2093:Itih4 UTSW 14 30891737 missense probably damaging 1.00
R2213:Itih4 UTSW 14 30890713 missense probably damaging 0.99
R2249:Itih4 UTSW 14 30899394 nonsense probably null
R2267:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2268:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2508:Itih4 UTSW 14 30895478 missense probably damaging 1.00
R3724:Itih4 UTSW 14 30892584 missense possibly damaging 0.60
R3859:Itih4 UTSW 14 30892329 missense probably damaging 1.00
R4042:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4044:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4246:Itih4 UTSW 14 30891402 missense probably damaging 1.00
R4422:Itih4 UTSW 14 30889864 missense probably damaging 1.00
R4553:Itih4 UTSW 14 30900953 missense probably damaging 1.00
R4608:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4609:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4726:Itih4 UTSW 14 30889835 missense probably damaging 1.00
R4790:Itih4 UTSW 14 30889910 missense probably damaging 1.00
R4975:Itih4 UTSW 14 30892287 missense probably damaging 1.00
R5004:Itih4 UTSW 14 30892672 missense probably damaging 1.00
R5911:Itih4 UTSW 14 30890655 missense possibly damaging 0.90
R6014:Itih4 UTSW 14 30892629 missense probably benign 0.01
R6957:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7012:Itih4 UTSW 14 30890749 missense probably benign 0.16
R7075:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7195:Itih4 UTSW 14 30899475 missense probably damaging 1.00
R7231:Itih4 UTSW 14 30896614 missense probably benign 0.17
R7509:Itih4 UTSW 14 30895447 missense probably benign 0.08
R7819:Itih4 UTSW 14 30901663 missense probably benign 0.00
R7967:Itih4 UTSW 14 30892413 missense probably damaging 1.00
R8084:Itih4 UTSW 14 30899443 missense possibly damaging 0.95
R8257:Itih4 UTSW 14 30887868 missense possibly damaging 0.93
R8534:Itih4 UTSW 14 30901022 missense probably benign 0.13
R8797:Itih4 UTSW 14 30896572 missense probably benign 0.00
R8886:Itih4 UTSW 14 30895525 nonsense probably null
R9006:Itih4 UTSW 14 30890129 missense probably damaging 1.00
R9035:Itih4 UTSW 14 30896693 missense probably benign 0.00
R9377:Itih4 UTSW 14 30886576 missense probably damaging 1.00
Z1176:Itih4 UTSW 14 30899462 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGCAAAGGACTCACCATTCTC -3'
(R):5'- GTCCCGGTAAAACTGACCTG -3'

Sequencing Primer
(F):5'- ACAGTGACTTCCTGGTCAAG -3'
(R):5'- CCGGTAAAACTGACCTGAGGTAAAG -3'
Posted On 2015-09-24