Incidental Mutation 'R4581:Rarg'
ID 343705
Institutional Source Beutler Lab
Gene Symbol Rarg
Ensembl Gene ENSMUSG00000001288
Gene Name retinoic acid receptor, gamma
Synonyms RAR gamma 2, RARgamma2
MMRRC Submission 041802-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 102234938-102257517 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 102252551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 18 (S18A)
Ref Sequence ENSEMBL: ENSMUSP00000118615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043172] [ENSMUST00000135466] [ENSMUST00000155563]
AlphaFold P18911
Predicted Effect probably benign
Transcript: ENSMUST00000043172
AA Change: S18A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048838
Gene: ENSMUSG00000001288
AA Change: S18A

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
HOLI 232 390 9.07e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135466
AA Change: S18A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118615
Gene: ENSMUSG00000001288
AA Change: S18A

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
PDB:1EXX|A 178 227 5e-28 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230330
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted growth, homeotic transformations of the rostral axial skeleton and tracheal cartilage, Harderian gland agenesis, high postnatal mortality, and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C A 15: 8,171,798 P20T possibly damaging Het
3425401B19Rik G T 14: 32,661,871 S712R possibly damaging Het
4933427I04Rik A G 4: 123,860,353 D20G possibly damaging Het
Abca7 A G 10: 80,006,568 D1112G probably benign Het
Actc1 G T 2: 114,049,608 H175N possibly damaging Het
Adgrd1 C T 5: 129,202,531 A863V possibly damaging Het
Ankrd17 T C 5: 90,283,120 D935G possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Arhgef4 G A 1: 34,732,124 E1171K possibly damaging Het
Ascc3 T C 10: 50,711,025 I991T probably damaging Het
Cacna1s T A 1: 136,070,970 probably null Het
Camk1d A T 2: 5,354,704 V177E probably benign Het
Cdh18 T A 15: 23,226,783 I110N probably damaging Het
Cenpe A G 3: 135,247,000 K1484E probably benign Het
Cep68 A G 11: 20,239,333 S560P probably benign Het
Cog3 G T 14: 75,732,951 T352K probably benign Het
Cox6a2 A G 7: 128,205,980 S44P possibly damaging Het
Csmd2 T C 4: 128,369,088 V689A probably benign Het
Ddx60 A T 8: 62,023,261 M1548L possibly damaging Het
Dennd5b G T 6: 149,016,984 silent Het
Dlgap2 T C 8: 14,846,679 Y1052H probably damaging Het
Dnaaf5 T A 5: 139,184,685 D502E probably damaging Het
Efhb C A 17: 53,426,275 A523S probably damaging Het
Epha8 C T 4: 136,933,464 V648M probably damaging Het
Fanca C T 8: 123,274,338 probably null Het
Fbxw7 G A 3: 84,967,545 E205K probably benign Het
Fer1l6 C T 15: 58,640,226 T1514I probably damaging Het
Gm12886 T C 4: 121,416,683 E112G probably damaging Het
Gm7535 T C 17: 17,911,083 probably benign Het
Irf2bp2 T A 8: 126,591,255 Q524L probably damaging Het
Itih4 A G 14: 30,900,968 D864G probably benign Het
Kdm4c T G 4: 74,357,339 probably null Het
Ltn1 A T 16: 87,402,024 probably null Het
Mafa G T 15: 75,747,736 P63T unknown Het
Mars2 T A 1: 55,237,862 L208H probably damaging Het
Myom2 A G 8: 15,106,459 I769V probably benign Het
Nyap1 A G 5: 137,736,022 S250P probably damaging Het
Olfr1082 A T 2: 86,594,228 M200K probably benign Het
Osmr C T 15: 6,842,894 V240I probably benign Het
Pcdhga3 A G 18: 37,676,881 T796A probably benign Het
Pclo T C 5: 14,675,505 V1459A unknown Het
Phactr3 A C 2: 178,283,172 H300P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plcd4 T A 1: 74,548,224 W48R probably damaging Het
Prdm16 A G 4: 154,323,353 S1140P probably damaging Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sec14l4 G A 11: 4,043,375 probably null Het
Six1 T G 12: 73,045,934 T165P probably benign Het
Skint4 T C 4: 112,087,042 L17P probably damaging Het
Slc25a23 T A 17: 57,052,740 Y337F probably damaging Het
Slc9a3 A G 13: 74,164,165 Y627C probably damaging Het
Smu1 A C 4: 40,737,401 probably null Het
Spryd3 A G 15: 102,130,364 S141P probably damaging Het
Src A T 2: 157,463,038 N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stc2 A G 11: 31,365,326 probably null Het
Taf6l T C 19: 8,778,208 D261G probably damaging Het
Tal1 T G 4: 115,064,722 V167G probably damaging Het
Tfec G A 6: 16,834,125 T261I probably damaging Het
Tgfb1 G T 7: 25,697,230 S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 V636E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc11 A T 8: 47,493,345 M1084K probably damaging Het
Trem3 A C 17: 48,249,611 T37P possibly damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Urb1 T C 16: 90,788,146 D529G probably benign Het
Vmn2r8 T A 5: 108,801,704 T426S probably benign Het
Yipf4 T C 17: 74,499,094 Y243H probably benign Het
Zfp574 T A 7: 25,081,313 C587S probably damaging Het
Zfp93 C A 7: 24,275,668 H359Q probably damaging Het
Znfx1 T C 2: 167,050,316 E660G probably damaging Het
Other mutations in Rarg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Rarg APN 15 102241939 splice site probably null
R0033:Rarg UTSW 15 102238835 missense probably damaging 0.99
R0539:Rarg UTSW 15 102238877 missense probably damaging 1.00
R1137:Rarg UTSW 15 102241160 missense probably damaging 1.00
R1593:Rarg UTSW 15 102239941 missense probably damaging 1.00
R1916:Rarg UTSW 15 102252445 missense probably benign 0.00
R1926:Rarg UTSW 15 102239545 missense probably damaging 1.00
R2057:Rarg UTSW 15 102239504 missense probably damaging 0.99
R2211:Rarg UTSW 15 102239524 missense probably benign 0.20
R5718:Rarg UTSW 15 102241067 missense probably damaging 1.00
R6197:Rarg UTSW 15 102241892 missense possibly damaging 0.94
R6991:Rarg UTSW 15 102241915 missense probably damaging 1.00
R7300:Rarg UTSW 15 102252417 critical splice donor site probably null
R8104:Rarg UTSW 15 102239899 missense probably damaging 1.00
R8121:Rarg UTSW 15 102239958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCCAACAAGGGTGTCC -3'
(R):5'- TTGGAAACCCACTGGACAG -3'

Sequencing Primer
(F):5'- CCAACAAGGGTGTCCATTTTCTAG -3'
(R):5'- CAGACCAGGCAGGGTGG -3'
Posted On 2015-09-24