Incidental Mutation 'R4581:Ltn1'
ID 343706
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Name listerin E3 ubiquitin protein ligase 1
Synonyms Listerin, Zfp294, Rnf160, 4930528H02Rik
MMRRC Submission 041802-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4581 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 87173539-87229500 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 87198912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449]
AlphaFold Q6A009
Predicted Effect probably null
Transcript: ENSMUST00000039449
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G T 14: 32,383,828 (GRCm39) S712R possibly damaging Het
4933427I04Rik A G 4: 123,754,146 (GRCm39) D20G possibly damaging Het
Abca7 A G 10: 79,842,402 (GRCm39) D1112G probably benign Het
Actc1 G T 2: 113,880,089 (GRCm39) H175N possibly damaging Het
Adgrd1 C T 5: 129,279,595 (GRCm39) A863V possibly damaging Het
Ankrd17 T C 5: 90,430,979 (GRCm39) D935G possibly damaging Het
Ankrd7 T A 6: 18,868,020 (GRCm39) N95K probably damaging Het
Arhgef4 G A 1: 34,771,205 (GRCm39) E1171K possibly damaging Het
Ascc3 T C 10: 50,587,121 (GRCm39) I991T probably damaging Het
Cacna1s T A 1: 135,998,708 (GRCm39) probably null Het
Camk1d A T 2: 5,359,515 (GRCm39) V177E probably benign Het
Cdh18 T A 15: 23,226,869 (GRCm39) I110N probably damaging Het
Cenpe A G 3: 134,952,761 (GRCm39) K1484E probably benign Het
Cep68 A G 11: 20,189,333 (GRCm39) S560P probably benign Het
Cog3 G T 14: 75,970,391 (GRCm39) T352K probably benign Het
Cox6a2 A G 7: 127,805,152 (GRCm39) S44P possibly damaging Het
Cplane1 C A 15: 8,201,282 (GRCm39) P20T possibly damaging Het
Csmd2 T C 4: 128,262,881 (GRCm39) V689A probably benign Het
Ddx60 A T 8: 62,476,295 (GRCm39) M1548L possibly damaging Het
Dennd5b G T 6: 148,918,482 (GRCm39) silent Het
Dlgap2 T C 8: 14,896,679 (GRCm39) Y1052H probably damaging Het
Dnaaf5 T A 5: 139,170,440 (GRCm39) D502E probably damaging Het
Efhb C A 17: 53,733,303 (GRCm39) A523S probably damaging Het
Epha8 C T 4: 136,660,775 (GRCm39) V648M probably damaging Het
Fanca C T 8: 124,001,077 (GRCm39) probably null Het
Fbxw7 G A 3: 84,874,852 (GRCm39) E205K probably benign Het
Fer1l6 C T 15: 58,512,075 (GRCm39) T1514I probably damaging Het
Gm12886 T C 4: 121,273,880 (GRCm39) E112G probably damaging Het
Gm7535 T C 17: 18,131,345 (GRCm39) probably benign Het
Irf2bp2 T A 8: 127,317,994 (GRCm39) Q524L probably damaging Het
Itih4 A G 14: 30,622,925 (GRCm39) D864G probably benign Het
Kdm4c T G 4: 74,275,576 (GRCm39) probably null Het
Mafa G T 15: 75,619,585 (GRCm39) P63T unknown Het
Mars2 T A 1: 55,277,021 (GRCm39) L208H probably damaging Het
Myom2 A G 8: 15,156,459 (GRCm39) I769V probably benign Het
Nyap1 A G 5: 137,734,284 (GRCm39) S250P probably damaging Het
Or8k35 A T 2: 86,424,572 (GRCm39) M200K probably benign Het
Osmr C T 15: 6,872,375 (GRCm39) V240I probably benign Het
Pcdhga3 A G 18: 37,809,934 (GRCm39) T796A probably benign Het
Pclo T C 5: 14,725,519 (GRCm39) V1459A unknown Het
Phactr3 A C 2: 177,924,965 (GRCm39) H300P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plcd4 T A 1: 74,587,383 (GRCm39) W48R probably damaging Het
Prdm16 A G 4: 154,407,810 (GRCm39) S1140P probably damaging Het
Rarg A C 15: 102,160,986 (GRCm39) S18A possibly damaging Het
Rfx4 T A 10: 84,680,164 (GRCm39) S114T possibly damaging Het
Sec14l4 G A 11: 3,993,375 (GRCm39) probably null Het
Six1 T G 12: 73,092,708 (GRCm39) T165P probably benign Het
Skint4 T C 4: 111,944,239 (GRCm39) L17P probably damaging Het
Slc25a23 T A 17: 57,359,740 (GRCm39) Y337F probably damaging Het
Slc9a3 A G 13: 74,312,284 (GRCm39) Y627C probably damaging Het
Smu1 A C 4: 40,737,401 (GRCm39) probably null Het
Spryd3 A G 15: 102,038,799 (GRCm39) S141P probably damaging Het
Src A T 2: 157,304,958 (GRCm39) N175I probably damaging Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,157,482 (GRCm39) probably benign Het
Stc2 A G 11: 31,315,326 (GRCm39) probably null Het
Taf6l T C 19: 8,755,572 (GRCm39) D261G probably damaging Het
Tal1 T G 4: 114,921,919 (GRCm39) V167G probably damaging Het
Tfec G A 6: 16,834,124 (GRCm39) T261I probably damaging Het
Tgfb1 G T 7: 25,396,655 (GRCm39) S273I possibly damaging Het
Tmem8b T A 4: 43,685,760 (GRCm39) V636E probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Trappc11 A T 8: 47,946,380 (GRCm39) M1084K probably damaging Het
Trem3 A C 17: 48,556,639 (GRCm39) T37P possibly damaging Het
Ttc7b G A 12: 100,466,376 (GRCm39) R79C probably damaging Het
Urb1 T C 16: 90,585,034 (GRCm39) D529G probably benign Het
Vmn2r8 T A 5: 108,949,570 (GRCm39) T426S probably benign Het
Yipf4 T C 17: 74,806,089 (GRCm39) Y243H probably benign Het
Zfp574 T A 7: 24,780,738 (GRCm39) C587S probably damaging Het
Zfp93 C A 7: 23,975,093 (GRCm39) H359Q probably damaging Het
Znfx1 T C 2: 166,892,236 (GRCm39) E660G probably damaging Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87,215,378 (GRCm39) missense probably benign 0.03
IGL01139:Ltn1 APN 16 87,212,897 (GRCm39) missense probably benign 0.04
IGL01359:Ltn1 APN 16 87,202,581 (GRCm39) splice site probably benign
IGL01503:Ltn1 APN 16 87,217,695 (GRCm39) critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87,178,359 (GRCm39) missense probably benign 0.00
IGL02437:Ltn1 APN 16 87,194,889 (GRCm39) missense probably benign 0.04
IGL02658:Ltn1 APN 16 87,212,662 (GRCm39) missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87,206,185 (GRCm39) splice site probably null
IGL02899:Ltn1 APN 16 87,179,547 (GRCm39) missense probably benign 0.34
IGL02902:Ltn1 APN 16 87,176,693 (GRCm39) missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87,212,832 (GRCm39) missense probably benign 0.00
IGL03392:Ltn1 APN 16 87,222,499 (GRCm39) missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87,202,509 (GRCm39) missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87,217,211 (GRCm39) missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87,177,728 (GRCm39) nonsense probably null
R0126:Ltn1 UTSW 16 87,222,528 (GRCm39) missense probably benign 0.00
R0164:Ltn1 UTSW 16 87,202,407 (GRCm39) splice site probably benign
R0165:Ltn1 UTSW 16 87,202,407 (GRCm39) splice site probably benign
R0280:Ltn1 UTSW 16 87,194,726 (GRCm39) missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87,212,898 (GRCm39) missense probably benign 0.01
R0733:Ltn1 UTSW 16 87,209,395 (GRCm39) missense probably benign 0.01
R1034:Ltn1 UTSW 16 87,194,025 (GRCm39) splice site probably null
R1252:Ltn1 UTSW 16 87,212,918 (GRCm39) missense probably benign 0.00
R1524:Ltn1 UTSW 16 87,178,444 (GRCm39) missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87,208,669 (GRCm39) missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87,212,504 (GRCm39) missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87,197,034 (GRCm39) missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87,213,152 (GRCm39) nonsense probably null
R1860:Ltn1 UTSW 16 87,213,231 (GRCm39) missense probably benign 0.06
R1997:Ltn1 UTSW 16 87,178,525 (GRCm39) missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87,212,530 (GRCm39) missense probably benign 0.03
R2134:Ltn1 UTSW 16 87,179,601 (GRCm39) missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87,179,601 (GRCm39) missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87,224,535 (GRCm39) missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87,229,312 (GRCm39) critical splice donor site probably null
R2376:Ltn1 UTSW 16 87,217,695 (GRCm39) critical splice donor site probably null
R3054:Ltn1 UTSW 16 87,200,961 (GRCm39) missense probably benign 0.32
R3404:Ltn1 UTSW 16 87,213,103 (GRCm39) missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87,213,103 (GRCm39) missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87,217,787 (GRCm39) missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87,213,118 (GRCm39) missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87,213,118 (GRCm39) missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87,213,118 (GRCm39) missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87,194,876 (GRCm39) missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87,202,502 (GRCm39) missense probably benign 0.17
R4535:Ltn1 UTSW 16 87,223,174 (GRCm39) missense probably damaging 1.00
R4669:Ltn1 UTSW 16 87,215,375 (GRCm39) missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87,215,382 (GRCm39) missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87,176,582 (GRCm39) missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87,195,697 (GRCm39) nonsense probably null
R4961:Ltn1 UTSW 16 87,194,679 (GRCm39) missense probably benign
R4992:Ltn1 UTSW 16 87,202,475 (GRCm39) missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87,224,628 (GRCm39) missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87,212,899 (GRCm39) missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87,212,569 (GRCm39) missense probably benign 0.17
R5907:Ltn1 UTSW 16 87,178,391 (GRCm39) missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87,224,677 (GRCm39) missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87,212,698 (GRCm39) missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87,208,662 (GRCm39) missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87,217,194 (GRCm39) missense probably benign
R6481:Ltn1 UTSW 16 87,175,868 (GRCm39) missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87,217,074 (GRCm39) missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87,194,679 (GRCm39) missense probably benign
R6969:Ltn1 UTSW 16 87,212,578 (GRCm39) missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87,220,361 (GRCm39) missense probably benign
R7038:Ltn1 UTSW 16 87,221,759 (GRCm39) missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87,224,491 (GRCm39) missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87,224,529 (GRCm39) missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87,215,382 (GRCm39) missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87,206,275 (GRCm39) missense probably benign 0.00
R7454:Ltn1 UTSW 16 87,194,700 (GRCm39) missense probably benign 0.03
R7471:Ltn1 UTSW 16 87,194,787 (GRCm39) missense probably benign
R7511:Ltn1 UTSW 16 87,205,716 (GRCm39) missense possibly damaging 0.63
R7691:Ltn1 UTSW 16 87,195,574 (GRCm39) missense probably damaging 0.99
R7702:Ltn1 UTSW 16 87,223,166 (GRCm39) missense probably damaging 1.00
R7761:Ltn1 UTSW 16 87,208,681 (GRCm39) missense probably benign
R8002:Ltn1 UTSW 16 87,212,835 (GRCm39) missense probably benign 0.17
R8101:Ltn1 UTSW 16 87,215,385 (GRCm39) missense probably damaging 1.00
R8142:Ltn1 UTSW 16 87,178,529 (GRCm39) missense probably benign 0.21
R8214:Ltn1 UTSW 16 87,177,691 (GRCm39) missense probably benign 0.02
R8674:Ltn1 UTSW 16 87,195,673 (GRCm39) missense probably benign
R8783:Ltn1 UTSW 16 87,207,247 (GRCm39) missense probably benign 0.30
R8839:Ltn1 UTSW 16 87,215,390 (GRCm39) missense probably damaging 1.00
R8885:Ltn1 UTSW 16 87,178,433 (GRCm39) missense probably damaging 1.00
R8889:Ltn1 UTSW 16 87,229,230 (GRCm39) intron probably benign
R8892:Ltn1 UTSW 16 87,229,230 (GRCm39) intron probably benign
R8919:Ltn1 UTSW 16 87,178,381 (GRCm39) missense probably damaging 0.98
R8970:Ltn1 UTSW 16 87,212,926 (GRCm39) missense probably benign
R9113:Ltn1 UTSW 16 87,224,532 (GRCm39) missense probably damaging 1.00
R9206:Ltn1 UTSW 16 87,197,298 (GRCm39) missense probably benign 0.00
R9208:Ltn1 UTSW 16 87,197,298 (GRCm39) missense probably benign 0.00
R9234:Ltn1 UTSW 16 87,194,089 (GRCm39) missense probably damaging 0.98
R9421:Ltn1 UTSW 16 87,215,375 (GRCm39) missense possibly damaging 0.90
R9558:Ltn1 UTSW 16 87,220,295 (GRCm39) missense probably benign 0.05
R9654:Ltn1 UTSW 16 87,207,227 (GRCm39) missense probably benign 0.00
R9738:Ltn1 UTSW 16 87,222,524 (GRCm39) missense probably damaging 1.00
X0028:Ltn1 UTSW 16 87,199,022 (GRCm39) missense probably benign 0.01
Z1177:Ltn1 UTSW 16 87,198,925 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTCAAATGCGCTCCATC -3'
(R):5'- TAGCAGCTATAGTCTGTTGGTTCC -3'

Sequencing Primer
(F):5'- TGCTCAAATGCGCTCCATCATAAC -3'
(R):5'- AGTCTGGATAACATCATTTTGCAC -3'
Posted On 2015-09-24