Mutagenetix > Incidental Mutation

Incidental Mutation 'R4581:Ltn1'

343706

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

041802-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 87402024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449]

AlphaFold

Q6A009

Predicted Effect

probably null
Transcript: ENSMUST00000039449

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Taf6l	T	C	19: 8,778,208	D261G	probably damaging	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3054:Ltn1	UTSW	16	87404073	missense	probably benign	0.32
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCTCAAATGCGCTCCATC -3'
(R):5'- TAGCAGCTATAGTCTGTTGGTTCC -3'

Sequencing Primer
(F):5'- TGCTCAAATGCGCTCCATCATAAC -3'
(R):5'- AGTCTGGATAACATCATTTTGCAC -3'

Posted On

2015-09-24