Mutagenetix > Incidental Mutation

Incidental Mutation 'R4581:Taf6l'

343714

Institutional Source

Beutler Lab

Gene Symbol

Taf6l

Ensembl Gene

ENSMUSG00000003680

Gene Name

TATA-box binding protein associated factor 6 like

Synonyms

PAF65A, 2810417N14Rik, C530024J06Rik

MMRRC Submission

041802-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R4581 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8772522-8786417 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8778208 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 261 (D261G)

Ref Sequence

ENSEMBL: ENSMUSP00000140136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000189739]

AlphaFold

Q8R2K4

Predicted Effect

probably damaging
Transcript: ENSMUST00000003777
AA Change: D286G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680
AA Change: D286G

Domain	Start	End	E-Value	Type
TAF	16	79	9.03e-28	SMART
Pfam:DUF1546	248	339	4.5e-29	PFAM
low complexity region	565	576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000010249

SMART Domains

Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	45	62	N/A	INTRINSIC
transmembrane domain	64	86	N/A	INTRINSIC
transmembrane domain	98	120	N/A	INTRINSIC
low complexity region	173	182	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176331

Predicted Effect

probably damaging
Transcript: ENSMUST00000176496
AA Change: D262G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680
AA Change: D262G

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:DUF1546	224	315	4.3e-29	PFAM
low complexity region	541	552	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176610
AA Change: D287G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680
AA Change: D287G

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:TAF6_C	249	338	6.6e-22	PFAM
low complexity region	566	577	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176719

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176747

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176991

Predicted Effect

probably benign
Transcript: ENSMUST00000177056
AA Change: D280G

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680
AA Change: D280G

Domain	Start	End	E-Value	Type
TAF	10	73	9.03e-28	SMART
Pfam:DUF1546	242	333	4.5e-29	PFAM
low complexity region	559	570	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177216
AA Change: D287G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680
AA Change: D287G

Domain	Start	End	E-Value	Type
TAF	17	80	9.03e-28	SMART
Pfam:DUF1546	249	340	6.4e-29	PFAM
low complexity region	566	577	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000189739
AA Change: D261G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680
AA Change: D261G

Domain	Start	End	E-Value	Type
TAF	16	79	3.8e-31	SMART
Pfam:DUF1546	223	314	6.3e-26	PFAM
low complexity region	540	551	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a protein that is a component of the PCAF histone acetylase complex and structurally similar to one of the histone-like TAFs, TAF6. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,171,798	P20T	possibly damaging	Het
3425401B19Rik	G	T	14: 32,661,871	S712R	possibly damaging	Het
4933427I04Rik	A	G	4: 123,860,353	D20G	possibly damaging	Het
Abca7	A	G	10: 80,006,568	D1112G	probably benign	Het
Actc1	G	T	2: 114,049,608	H175N	possibly damaging	Het
Adgrd1	C	T	5: 129,202,531	A863V	possibly damaging	Het
Ankrd17	T	C	5: 90,283,120	D935G	possibly damaging	Het
Ankrd7	T	A	6: 18,868,021	N95K	probably damaging	Het
Arhgef4	G	A	1: 34,732,124	E1171K	possibly damaging	Het
Ascc3	T	C	10: 50,711,025	I991T	probably damaging	Het
Cacna1s	T	A	1: 136,070,970		probably null	Het
Camk1d	A	T	2: 5,354,704	V177E	probably benign	Het
Cdh18	T	A	15: 23,226,783	I110N	probably damaging	Het
Cenpe	A	G	3: 135,247,000	K1484E	probably benign	Het
Cep68	A	G	11: 20,239,333	S560P	probably benign	Het
Cog3	G	T	14: 75,732,951	T352K	probably benign	Het
Cox6a2	A	G	7: 128,205,980	S44P	possibly damaging	Het
Csmd2	T	C	4: 128,369,088	V689A	probably benign	Het
Ddx60	A	T	8: 62,023,261	M1548L	possibly damaging	Het
Dennd5b	G	T	6: 149,016,984		silent	Het
Dlgap2	T	C	8: 14,846,679	Y1052H	probably damaging	Het
Dnaaf5	T	A	5: 139,184,685	D502E	probably damaging	Het
Efhb	C	A	17: 53,426,275	A523S	probably damaging	Het
Epha8	C	T	4: 136,933,464	V648M	probably damaging	Het
Fanca	C	T	8: 123,274,338		probably null	Het
Fbxw7	G	A	3: 84,967,545	E205K	probably benign	Het
Fer1l6	C	T	15: 58,640,226	T1514I	probably damaging	Het
Gm12886	T	C	4: 121,416,683	E112G	probably damaging	Het
Gm7535	T	C	17: 17,911,083		probably benign	Het
Irf2bp2	T	A	8: 126,591,255	Q524L	probably damaging	Het
Itih4	A	G	14: 30,900,968	D864G	probably benign	Het
Kdm4c	T	G	4: 74,357,339		probably null	Het
Ltn1	A	T	16: 87,402,024		probably null	Het
Mafa	G	T	15: 75,747,736	P63T	unknown	Het
Mars2	T	A	1: 55,237,862	L208H	probably damaging	Het
Myom2	A	G	8: 15,106,459	I769V	probably benign	Het
Nyap1	A	G	5: 137,736,022	S250P	probably damaging	Het
Olfr1082	A	T	2: 86,594,228	M200K	probably benign	Het
Osmr	C	T	15: 6,842,894	V240I	probably benign	Het
Pcdhga3	A	G	18: 37,676,881	T796A	probably benign	Het
Pclo	T	C	5: 14,675,505	V1459A	unknown	Het
Phactr3	A	C	2: 178,283,172	H300P	probably damaging	Het
Pla2g4e	T	G	2: 120,186,382	H226P	possibly damaging	Het
Plcd4	T	A	1: 74,548,224	W48R	probably damaging	Het
Prdm16	A	G	4: 154,323,353	S1140P	probably damaging	Het
Rarg	A	C	15: 102,252,551	S18A	possibly damaging	Het
Rfx4	T	A	10: 84,844,300	S114T	possibly damaging	Het
Sec14l4	G	A	11: 4,043,375		probably null	Het
Six1	T	G	12: 73,045,934	T165P	probably benign	Het
Skint4	T	C	4: 112,087,042	L17P	probably damaging	Het
Slc25a23	T	A	17: 57,052,740	Y337F	probably damaging	Het
Slc9a3	A	G	13: 74,164,165	Y627C	probably damaging	Het
Smu1	A	C	4: 40,737,401		probably null	Het
Spryd3	A	G	15: 102,130,364	S141P	probably damaging	Het
Src	A	T	2: 157,463,038	N175I	probably damaging	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stc2	A	G	11: 31,365,326		probably null	Het
Tal1	T	G	4: 115,064,722	V167G	probably damaging	Het
Tfec	G	A	6: 16,834,125	T261I	probably damaging	Het
Tgfb1	G	T	7: 25,697,230	S273I	possibly damaging	Het
Tmem8b	T	A	4: 43,685,760	V636E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc11	A	T	8: 47,493,345	M1084K	probably damaging	Het
Trem3	A	C	17: 48,249,611	T37P	possibly damaging	Het
Ttc7b	G	A	12: 100,500,117	R79C	probably damaging	Het
Urb1	T	C	16: 90,788,146	D529G	probably benign	Het
Vmn2r8	T	A	5: 108,801,704	T426S	probably benign	Het
Yipf4	T	C	17: 74,499,094	Y243H	probably benign	Het
Zfp574	T	A	7: 25,081,313	C587S	probably damaging	Het
Zfp93	C	A	7: 24,275,668	H359Q	probably damaging	Het
Znfx1	T	C	2: 167,050,316	E660G	probably damaging	Het

Other mutations in Taf6l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Taf6l	APN	19	8783388	missense	probably benign	0.04
IGL00781:Taf6l	APN	19	8773661	missense	probably damaging	1.00
IGL01886:Taf6l	APN	19	8778086	critical splice donor site	probably null
IGL02638:Taf6l	APN	19	8775266	missense	probably benign	0.03
IGL02676:Taf6l	APN	19	8775049	missense	probably damaging	1.00
R0096:Taf6l	UTSW	19	8778517	missense	probably benign	0.06
R0110:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0469:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0510:Taf6l	UTSW	19	8778521	missense	probably benign	0.08
R0676:Taf6l	UTSW	19	8773369	missense	probably benign	0.00
R0711:Taf6l	UTSW	19	8778517	missense	probably benign	0.06
R1804:Taf6l	UTSW	19	8773634	missense	probably damaging	0.99
R1971:Taf6l	UTSW	19	8775502	splice site	probably null
R2869:Taf6l	UTSW	19	8778628	unclassified	probably benign
R2870:Taf6l	UTSW	19	8778628	unclassified	probably benign
R3105:Taf6l	UTSW	19	8778855	missense	probably damaging	1.00
R4578:Taf6l	UTSW	19	8783971	missense	possibly damaging	0.95
R4841:Taf6l	UTSW	19	8782406	missense	possibly damaging	0.77
R4842:Taf6l	UTSW	19	8782406	missense	possibly damaging	0.77
R5215:Taf6l	UTSW	19	8778053	intron	probably benign
R5269:Taf6l	UTSW	19	8774962	missense	probably damaging	1.00
R5571:Taf6l	UTSW	19	8783930	missense	probably damaging	1.00
R5687:Taf6l	UTSW	19	8773312	missense	probably benign	0.01
R5799:Taf6l	UTSW	19	8782631	missense	possibly damaging	0.93
R5814:Taf6l	UTSW	19	8774846	missense	probably benign	0.13
R6008:Taf6l	UTSW	19	8778166	missense	possibly damaging	0.65
R6091:Taf6l	UTSW	19	8778556	missense	probably benign	0.04
R6228:Taf6l	UTSW	19	8778666	missense	probably benign	0.01
R6569:Taf6l	UTSW	19	8772710	missense	probably damaging	1.00
R6768:Taf6l	UTSW	19	8774549	missense	probably damaging	1.00
R7586:Taf6l	UTSW	19	8783846	missense	probably damaging	0.99
R8282:Taf6l	UTSW	19	8773350	missense	possibly damaging	0.95
R8959:Taf6l	UTSW	19	8773326	missense	possibly damaging	0.52
R8963:Taf6l	UTSW	19	8774771	missense	probably benign
R9225:Taf6l	UTSW	19	8774324	critical splice donor site	probably benign
R9340:Taf6l	UTSW	19	8775272	missense	probably damaging	1.00
R9488:Taf6l	UTSW	19	8782072	missense	probably benign	0.44
Z1176:Taf6l	UTSW	19	8782544	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- GCTTTGTAACACAGCCACTC -3'
(R):5'- GAGCTGTAGGAAGCCTTTGG -3'

Sequencing Primer
(F):5'- GCCACTCTCAAAGGTCTGAG -3'
(R):5'- TAGCCCCCTAGCTGACATG -3'

Posted On

2015-09-24