Incidental Mutation 'R4582:Dhrs9'
List |< first << previous [record 12 of 43] next >> last >|
ID343719
Institutional Source Beutler Lab
Gene Symbol Dhrs9
Ensembl Gene ENSMUSG00000027068
Gene Namedehydrogenase/reductase (SDR family) member 9
SynonymsRdh15, C730025I08Rik
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4582 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location69380445-69404533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69397653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 204 (I204F)
Ref Sequence ENSEMBL: ENSMUSP00000069631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063690]
Predicted Effect probably damaging
Transcript: ENSMUST00000063690
AA Change: I204F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069631
Gene: ENSMUSG00000027068
AA Change: I204F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:adh_short 30 222 2.3e-41 PFAM
Pfam:adh_short_C2 36 237 1.4e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. This protein demonstrates oxidoreductase activity toward hydroxysteroids and is able to convert 3-alpha-tetrahydroprogesterone to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone in the cytoplasm, and may additionally function as a transcriptional repressor in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Dhrs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2267:Dhrs9 UTSW 2 69392853 splice site probably benign
R2425:Dhrs9 UTSW 2 69392964 missense probably benign 0.43
R4573:Dhrs9 UTSW 2 69397641 missense probably benign 0.21
R4916:Dhrs9 UTSW 2 69401408 missense probably damaging 1.00
R5045:Dhrs9 UTSW 2 69392995 missense probably benign 0.00
R5048:Dhrs9 UTSW 2 69394400 missense probably damaging 1.00
R5640:Dhrs9 UTSW 2 69394478 missense probably damaging 0.99
R6342:Dhrs9 UTSW 2 69393187 missense probably benign 0.19
R6630:Dhrs9 UTSW 2 69397723 missense possibly damaging 0.53
R7034:Dhrs9 UTSW 2 69393176 missense probably benign 0.02
R7157:Dhrs9 UTSW 2 69393158 missense probably damaging 1.00
R7457:Dhrs9 UTSW 2 69401267 missense probably benign 0.00
R7610:Dhrs9 UTSW 2 69392947 missense unknown
R7821:Dhrs9 UTSW 2 69394438 missense probably damaging 1.00
R7851:Dhrs9 UTSW 2 69401256 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CACCCTCCAGATAAGTTTGACTG -3'
(R):5'- ATTCTGACCAGGACAGGGGATC -3'

Sequencing Primer
(F):5'- CTCCAGATAAGTTTGACTGAAACAC -3'
(R):5'- CAATGTAGCCCTCTCCAT -3'
Posted On2015-09-24