Incidental Mutation 'R4582:Olfr1338'
ID343720
Institutional Source Beutler Lab
Gene Symbol Olfr1338
Ensembl Gene ENSMUSG00000095218
Gene Nameolfactory receptor 1338
SynonymsMOR259-9, GA_x6K02T2QD9B-18795136-18796077, MOR259-4P, MOR259-4P, Olfr1524-ps1
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118751975-118758737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118753893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 217 (I217N)
Ref Sequence ENSEMBL: ENSMUSP00000149843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084315] [ENSMUST00000214922] [ENSMUST00000216559]
Predicted Effect probably damaging
Transcript: ENSMUST00000084315
AA Change: I215N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092427
Gene: ENSMUSG00000095218
AA Change: I215N

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-55 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1e-8 PFAM
Pfam:7tm_1 42 291 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214922
AA Change: I217N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216559
AA Change: I217N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Olfr1338
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr1338 APN 4 118753762 missense possibly damaging 0.78
IGL02726:Olfr1338 APN 4 118753764 missense probably benign 0.00
IGL02928:Olfr1338 APN 4 118754500 missense probably damaging 1.00
IGL03102:Olfr1338 APN 4 118753934 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0062:Olfr1338 UTSW 4 118753903 missense probably benign 0.00
R0299:Olfr1338 UTSW 4 118754535 start codon destroyed probably null 0.82
R0501:Olfr1338 UTSW 4 118753830 missense probably benign 0.00
R1301:Olfr1338 UTSW 4 118753619 missense probably benign
R1719:Olfr1338 UTSW 4 118753600 missense possibly damaging 0.78
R2327:Olfr1338 UTSW 4 118754134 missense probably benign 0.13
R3110:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R3112:Olfr1338 UTSW 4 118754224 missense probably damaging 0.99
R4615:Olfr1338 UTSW 4 118754137 missense probably benign 0.34
R5640:Olfr1338 UTSW 4 118753789 missense probably benign 0.07
R6513:Olfr1338 UTSW 4 118754027 nonsense probably null
R6889:Olfr1338 UTSW 4 118754307 missense probably damaging 0.99
R7157:Olfr1338 UTSW 4 118754418 missense possibly damaging 0.93
R7168:Olfr1338 UTSW 4 118753851 missense probably damaging 0.98
R7378:Olfr1338 UTSW 4 118754175 missense possibly damaging 0.74
R7451:Olfr1338 UTSW 4 118753687 missense probably benign 0.03
R7770:Olfr1338 UTSW 4 118754057 missense probably benign 0.04
R7847:Olfr1338 UTSW 4 118754368 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGTGAGATCTGCTTGTCTCTC -3'
(R):5'- GTGCATACGATTGGCAGCAG -3'

Sequencing Primer
(F):5'- GTCTCTCTCAGGGGAGTAGC -3'
(R):5'- CAGCAGGGACTTGGATCTG -3'
Posted On2015-09-24