Incidental Mutation 'R4582:Gtpbp10'
ID343722
Institutional Source Beutler Lab
Gene Symbol Gtpbp10
Ensembl Gene ENSMUSG00000040464
Gene NameGTP-binding protein 10 (putative)
Synonyms4930545J22Rik
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5537454-5559538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5542395 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 191 (T191A)
Ref Sequence ENSEMBL: ENSMUSP00000086225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088842] [ENSMUST00000115441] [ENSMUST00000119521] [ENSMUST00000147244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088842
AA Change: T191A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086225
Gene: ENSMUSG00000040464
AA Change: T191A

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Pfam:FeoB_N 75 163 3e-7 PFAM
Pfam:MMR_HSR1 77 200 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115441
AA Change: T270A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111101
Gene: ENSMUSG00000040464
AA Change: T270A

DomainStartEndE-ValueType
Pfam:GTP1_OBG 15 142 1.3e-18 PFAM
Pfam:FeoB_N 149 241 1.4e-8 PFAM
Pfam:MMR_HSR1 150 279 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119521
AA Change: T197A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113648
Gene: ENSMUSG00000040464
AA Change: T197A

DomainStartEndE-ValueType
Pfam:GTP1_OBG 15 118 6.7e-14 PFAM
Pfam:MMR_HSR1 95 206 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126855
SMART Domains Protein: ENSMUSP00000118395
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127670
Predicted Effect probably benign
Transcript: ENSMUST00000128887
SMART Domains Protein: ENSMUSP00000121101
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
Pfam:GTP1_OBG 1 85 2.7e-11 PFAM
low complexity region 101 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147244
SMART Domains Protein: ENSMUSP00000119250
Gene: ENSMUSG00000040464

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198421
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small G proteins, such as GTPBP10, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Gtpbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Gtpbp10 APN 5 5546372 missense possibly damaging 0.71
IGL02654:Gtpbp10 APN 5 5543372 unclassified probably benign
IGL03170:Gtpbp10 APN 5 5555355 missense probably benign 0.03
R0421:Gtpbp10 UTSW 5 5557290 missense probably benign 0.00
R4832:Gtpbp10 UTSW 5 5539295 missense possibly damaging 0.85
R6437:Gtpbp10 UTSW 5 5557406 missense probably damaging 1.00
R6969:Gtpbp10 UTSW 5 5555331 missense probably damaging 1.00
R7072:Gtpbp10 UTSW 5 5546365 missense probably benign
R7349:Gtpbp10 UTSW 5 5555379 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACACTAGTTTTCTTTCCCATTGAT -3'
(R):5'- CTGTTGACTCTGGTTGGCAC -3'

Sequencing Primer
(F):5'- CTATAACTCTAGCACCTGGGAGG -3'
(R):5'- CTGGGAAGTCCTGTGAGCTAACATC -3'
Posted On2015-09-24