Incidental Mutation 'R4582:Lrrc66'
ID343723
Institutional Source Beutler Lab
Gene Symbol Lrrc66
Ensembl Gene ENSMUSG00000067206
Gene Nameleucine rich repeat containing 66
SynonymsMGC:38937
MMRRC Submission 041803-MU
Accession Numbers

Genbank: NM_153568; MGI: 2387634

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73606642-73632526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73608237 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 488 (S488G)
Ref Sequence ENSEMBL: ENSMUSP00000084423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087177
AA Change: S488G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084423
Gene: ENSMUSG00000067206
AA Change: S488G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 140 162 1.81e1 SMART
LRR_TYP 163 186 9.44e-2 SMART
LRR 187 210 1.26e2 SMART
LRR 211 234 4.84e1 SMART
low complexity region 298 309 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 842 859 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Lrrc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Lrrc66 APN 5 73607114 missense probably benign 0.10
IGL00913:Lrrc66 APN 5 73608156 missense possibly damaging 0.76
IGL00954:Lrrc66 APN 5 73608398 missense possibly damaging 0.94
IGL01061:Lrrc66 APN 5 73615499 missense probably benign 0.01
IGL01343:Lrrc66 APN 5 73608463 missense probably damaging 0.98
IGL01714:Lrrc66 APN 5 73629977 missense probably benign 0.10
IGL01822:Lrrc66 APN 5 73629968 missense probably benign 0.17
IGL02005:Lrrc66 APN 5 73608734 missense possibly damaging 0.83
IGL02166:Lrrc66 APN 5 73607291 missense probably damaging 0.99
IGL02380:Lrrc66 APN 5 73629666 missense possibly damaging 0.55
IGL03162:Lrrc66 APN 5 73607382 missense probably benign
D4043:Lrrc66 UTSW 5 73607526 missense probably benign 0.03
R0126:Lrrc66 UTSW 5 73607088 missense probably benign 0.10
R0437:Lrrc66 UTSW 5 73607687 missense probably benign 0.23
R0638:Lrrc66 UTSW 5 73615473 splice site probably benign
R0658:Lrrc66 UTSW 5 73610944 missense probably benign 0.40
R0729:Lrrc66 UTSW 5 73608414 missense probably benign
R1603:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1774:Lrrc66 UTSW 5 73610855 missense probably benign 0.16
R1831:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1832:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1902:Lrrc66 UTSW 5 73607622 missense probably damaging 0.99
R2858:Lrrc66 UTSW 5 73607303 missense probably benign 0.08
R4097:Lrrc66 UTSW 5 73607704 missense possibly damaging 0.94
R4164:Lrrc66 UTSW 5 73629776 unclassified probably null
R4708:Lrrc66 UTSW 5 73629662 missense probably benign 0.06
R4856:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R4886:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R5074:Lrrc66 UTSW 5 73608011 missense probably damaging 1.00
R5464:Lrrc66 UTSW 5 73608279 missense probably benign 0.05
R5640:Lrrc66 UTSW 5 73608634 missense probably benign 0.00
R5709:Lrrc66 UTSW 5 73608863 missense probably benign
R5811:Lrrc66 UTSW 5 73615517 missense possibly damaging 0.82
R6146:Lrrc66 UTSW 5 73608089 missense probably benign 0.10
R7037:Lrrc66 UTSW 5 73607161 missense probably benign 0.10
R7041:Lrrc66 UTSW 5 73608556 missense possibly damaging 0.81
R7141:Lrrc66 UTSW 5 73629977 missense probably benign 0.10
R7201:Lrrc66 UTSW 5 73629897 missense probably benign 0.11
R7250:Lrrc66 UTSW 5 73610881 missense probably benign 0.03
R7367:Lrrc66 UTSW 5 73608381 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAAGACCTGTCCATCACATCGTC -3'
(R):5'- GCGACATTGAAGGTGCTCAAC -3'

Sequencing Primer
(F):5'- TCGTCAATGAGAGAATATTCCTGGGC -3'
(R):5'- TGCTCAACACATGGAGTACC -3'
Posted On2015-09-24