Incidental Mutation 'R4582:Pde6b'
List |< first << previous [record 28 of 43] next >> last >|
ID343725
Institutional Source Beutler Lab
Gene Symbol Pde6b
Ensembl Gene ENSMUSG00000029491
Gene Namephosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonymsrd10, Pdeb, rd, rd1, r
MMRRC Submission 041803-MU
Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108388391-108432397 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 108425231 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031456]
Predicted Effect probably null
Transcript: ENSMUST00000031456
SMART Domains Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491

DomainStartEndE-ValueType
GAF 71 230 1.29e-27 SMART
GAF 252 439 5.76e-25 SMART
Blast:HDc 484 538 1e-24 BLAST
HDc 554 732 1.25e-9 SMART
Blast:HDc 757 792 8e-13 BLAST
low complexity region 813 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134865
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Pde6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pde6b APN 5 108426571 splice site probably benign
IGL01071:Pde6b APN 5 108419715 nonsense probably null
IGL01335:Pde6b APN 5 108423513 missense probably benign 0.03
IGL01611:Pde6b APN 5 108403396 missense possibly damaging 0.90
IGL01881:Pde6b APN 5 108421500 missense probably benign 0.01
IGL01941:Pde6b APN 5 108423036 missense probably benign 0.11
IGL02616:Pde6b APN 5 108431541 missense probably benign 0.05
IGL02657:Pde6b APN 5 108420276 splice site probably benign
IGL03217:Pde6b APN 5 108419566 missense probably damaging 1.00
Bemr28 UTSW 5 unclassified
D4043:Pde6b UTSW 5 108425356 nonsense probably null
N/A:Pde6b UTSW 5 108429103 unclassified probably benign
PIT4362001:Pde6b UTSW 5 108423585 critical splice donor site probably null
PIT4581001:Pde6b UTSW 5 108428508 missense probably benign 0.01
R0940:Pde6b UTSW 5 108420337 missense possibly damaging 0.95
R0963:Pde6b UTSW 5 108430668 missense probably benign
R1738:Pde6b UTSW 5 108430559 nonsense probably null
R1753:Pde6b UTSW 5 108388691 nonsense probably null
R1801:Pde6b UTSW 5 108427847 missense possibly damaging 0.51
R1913:Pde6b UTSW 5 108427190 missense probably benign 0.05
R2131:Pde6b UTSW 5 108428203 missense probably damaging 1.00
R2282:Pde6b UTSW 5 108423586 splice site probably null
R3713:Pde6b UTSW 5 108423062 missense probably damaging 1.00
R4385:Pde6b UTSW 5 108427642 missense probably benign 0.08
R4562:Pde6b UTSW 5 108403368 missense probably benign 0.23
R4939:Pde6b UTSW 5 108421497 missense probably benign 0.01
R4950:Pde6b UTSW 5 108430703 missense probably benign 0.16
R4972:Pde6b UTSW 5 108425264 missense probably benign 0.00
R4983:Pde6b UTSW 5 108425330 missense probably benign 0.21
R5056:Pde6b UTSW 5 108423491 nonsense probably null
R5514:Pde6b UTSW 5 108423451 missense probably benign 0.06
R5528:Pde6b UTSW 5 108423558 missense probably benign 0.04
R5937:Pde6b UTSW 5 108424327 missense probably benign 0.00
R6556:Pde6b UTSW 5 108421501 missense possibly damaging 0.56
R6826:Pde6b UTSW 5 108430592 nonsense probably null
R6884:Pde6b UTSW 5 108388708 missense probably damaging 0.99
R7213:Pde6b UTSW 5 108404090 missense probably damaging 1.00
R7444:Pde6b UTSW 5 108427142 nonsense probably null
R7690:Pde6b UTSW 5 108419518 missense probably damaging 1.00
R7909:Pde6b UTSW 5 108403422 missense probably benign 0.01
R7937:Pde6b UTSW 5 108419773 critical splice donor site probably null
R8049:Pde6b UTSW 5 108425252 missense probably benign 0.04
R8087:Pde6b UTSW 5 108388462 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCAAGCTTCTCACTGTCAG -3'
(R):5'- GGGACCTGTAACCTTTACCACC -3'

Sequencing Primer
(F):5'- GCAAGCTTCTCACTGTCAGGTTAC -3'
(R):5'- ACTTCCTCTTGTTCTGGAACC -3'
Posted On2015-09-24