Incidental Mutation 'R4582:Ankrd7'
List |< first << previous [record 3 of 43] next >> last >|
ID343727
Institutional Source Beutler Lab
Gene Symbol Ankrd7
Ensembl Gene ENSMUSG00000029517
Gene Nameankyrin repeat domain 7
Synonyms
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location18866318-18879586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18868021 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 95 (N95K)
Ref Sequence ENSEMBL: ENSMUSP00000111054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031489] [ENSMUST00000115396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031489
AA Change: N95K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031489
Gene: ENSMUSG00000029517
AA Change: N95K

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
ANK 80 109 1.06e-4 SMART
ANK 113 142 5.45e-2 SMART
ANK 146 175 6.92e-4 SMART
ANK 179 208 1.94e-7 SMART
ANK 212 241 1.99e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115396
AA Change: N95K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111054
Gene: ENSMUSG00000029517
AA Change: N95K

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
ANK 80 109 1.06e-4 SMART
ANK 113 143 3.07e2 SMART
ANK 147 176 6.92e-4 SMART
ANK 180 209 1.94e-7 SMART
ANK 213 242 1.99e2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Ankrd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Ankrd7 APN 6 18879346 missense probably damaging 0.99
IGL01336:Ankrd7 APN 6 18868278 missense probably benign 0.05
IGL01916:Ankrd7 APN 6 18868251 missense possibly damaging 0.65
IGL02398:Ankrd7 APN 6 18866697 missense probably damaging 0.99
R0031:Ankrd7 UTSW 6 18870008 nonsense probably null
R0157:Ankrd7 UTSW 6 18866540 missense probably damaging 0.98
R0207:Ankrd7 UTSW 6 18870031 missense probably benign 0.09
R2154:Ankrd7 UTSW 6 18870031 missense probably benign 0.09
R4255:Ankrd7 UTSW 6 18869881 splice site probably null
R4581:Ankrd7 UTSW 6 18868021 missense probably damaging 0.99
R4958:Ankrd7 UTSW 6 18866723 missense probably benign 0.05
R5194:Ankrd7 UTSW 6 18868077 missense possibly damaging 0.67
R6077:Ankrd7 UTSW 6 18868072 missense probably benign 0.08
R6731:Ankrd7 UTSW 6 18866654 missense probably damaging 1.00
R6898:Ankrd7 UTSW 6 18868101 splice site probably null
R7170:Ankrd7 UTSW 6 18868390 nonsense probably null
R7194:Ankrd7 UTSW 6 18879343 missense probably benign 0.00
R7749:Ankrd7 UTSW 6 18879516 splice site probably null
R8348:Ankrd7 UTSW 6 18868008 missense probably damaging 0.96
R8383:Ankrd7 UTSW 6 18868411 missense possibly damaging 0.86
R8448:Ankrd7 UTSW 6 18868008 missense probably damaging 0.96
RF012:Ankrd7 UTSW 6 18869275 missense possibly damaging 0.76
Z1177:Ankrd7 UTSW 6 18866564 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAGAGCAATCTGAATTGTGTTAGG -3'
(R):5'- TACTGCCTGCTAGTGGAACAAG -3'

Sequencing Primer
(F):5'- AGCAATCTGAATTGTGTTAGGGTATC -3'
(R):5'- GAGTGGACAACTTCCTATTTCAGG -3'
Posted On2015-09-24