Incidental Mutation 'R4582:Vmn1r29'
List |< first << previous [record 42 of 43] next >> last >|
ID343729
Institutional Source Beutler Lab
Gene Symbol Vmn1r29
Ensembl Gene ENSMUSG00000091734
Gene Namevomeronasal 1 receptor 29
SynonymsV1rc2
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location58301549-58311685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58308032 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 246 (I246L)
Ref Sequence ENSEMBL: ENSMUSP00000154278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168416] [ENSMUST00000226971] [ENSMUST00000227761] [ENSMUST00000228038] [ENSMUST00000228909]
Predicted Effect probably damaging
Transcript: ENSMUST00000168416
AA Change: I246L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129069
Gene: ENSMUSG00000091734
AA Change: I246L

DomainStartEndE-ValueType
Pfam:V1R 28 293 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226971
AA Change: I246L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227761
AA Change: I246L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228038
AA Change: I246L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228909
AA Change: I246L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Vmn1r29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02504:Vmn1r29 APN 6 58307670 missense probably benign 0.03
IGL03351:Vmn1r29 APN 6 58307750 missense probably damaging 1.00
R0457:Vmn1r29 UTSW 6 58308087 missense probably benign 0.35
R0594:Vmn1r29 UTSW 6 58307772 missense probably benign 0.35
R0735:Vmn1r29 UTSW 6 58307732 missense probably damaging 0.96
R1422:Vmn1r29 UTSW 6 58307886 missense probably damaging 1.00
R1476:Vmn1r29 UTSW 6 58307678 missense probably benign 0.23
R1679:Vmn1r29 UTSW 6 58308018 missense probably damaging 1.00
R1831:Vmn1r29 UTSW 6 58307707 nonsense probably null
R1925:Vmn1r29 UTSW 6 58308102 missense possibly damaging 0.79
R1933:Vmn1r29 UTSW 6 58307420 missense probably benign 0.03
R4677:Vmn1r29 UTSW 6 58307300 missense probably benign 0.02
R4706:Vmn1r29 UTSW 6 58308151 missense probably benign 0.00
R5023:Vmn1r29 UTSW 6 58308067 nonsense probably null
R5542:Vmn1r29 UTSW 6 58308123 missense probably benign 0.14
R5649:Vmn1r29 UTSW 6 58307691 missense probably benign 0.13
R5656:Vmn1r29 UTSW 6 58308167 missense possibly damaging 0.94
R5906:Vmn1r29 UTSW 6 58307751 missense probably benign 0.19
R6078:Vmn1r29 UTSW 6 58308095 missense probably benign 0.01
R6349:Vmn1r29 UTSW 6 58307427 missense probably damaging 1.00
R7946:Vmn1r29 UTSW 6 58307849 missense probably benign 0.18
RF020:Vmn1r29 UTSW 6 58307543 missense probably benign 0.01
U15987:Vmn1r29 UTSW 6 58308095 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTCACTAAATCCTGTACACTC -3'
(R):5'- AAATTCTGGCGGTGCTTTGAC -3'

Sequencing Primer
(F):5'- ACAGTGTCAATCTCCAGAGATG -3'
(R):5'- GTGCTTTGACTGCATGTTTTCCAAC -3'
Posted On2015-09-24