Incidental Mutation 'R4582:Slc22a5'
ID343744
Institutional Source Beutler Lab
Gene Symbol Slc22a5
Ensembl Gene ENSMUSG00000018900
Gene Namesolute carrier family 22 (organic cation transporter), member 5
SynonymsLstpl, Octn2
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53864542-53891660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53891209 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 111 (E111K)
Ref Sequence ENSEMBL: ENSMUSP00000019044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019044] [ENSMUST00000136307]
Predicted Effect probably damaging
Transcript: ENSMUST00000019044
AA Change: E111K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019044
Gene: ENSMUSG00000018900
AA Change: E111K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 57 524 1.7e-28 PFAM
Pfam:MFS_1 138 478 2.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136307
AA Change: E111K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118900
Gene: ENSMUSG00000018900
AA Change: E111K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a spontaneous missense mutation exhibit systemic carnitine deficiency, cardiac hypertrophy, impaired Na-dependent carnitine transport, fatty liver, hypoglycemia, high postnatal mortality, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Slc22a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Slc22a5 APN 11 53867664 missense probably benign 0.39
IGL02063:Slc22a5 APN 11 53875073 missense probably damaging 0.99
IGL03008:Slc22a5 APN 11 53891232 missense probably damaging 1.00
IGL03190:Slc22a5 APN 11 53875014 missense probably benign 0.02
R0055:Slc22a5 UTSW 11 53891206 missense probably benign 0.00
R0190:Slc22a5 UTSW 11 53869415 nonsense probably null
R1498:Slc22a5 UTSW 11 53869314 missense probably damaging 1.00
R1729:Slc22a5 UTSW 11 53866351 missense probably damaging 1.00
R1784:Slc22a5 UTSW 11 53866351 missense probably damaging 1.00
R2249:Slc22a5 UTSW 11 53883706 missense possibly damaging 0.73
R3426:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3427:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3428:Slc22a5 UTSW 11 53869326 missense probably benign 0.03
R3895:Slc22a5 UTSW 11 53865825 missense possibly damaging 0.64
R4965:Slc22a5 UTSW 11 53891526 missense possibly damaging 0.94
R5898:Slc22a5 UTSW 11 53873733 missense probably damaging 1.00
R6018:Slc22a5 UTSW 11 53876020 missense probably damaging 1.00
R6063:Slc22a5 UTSW 11 53867533 missense possibly damaging 0.79
R6218:Slc22a5 UTSW 11 53891618 unclassified probably benign
R6369:Slc22a5 UTSW 11 53891370 missense probably damaging 1.00
R6827:Slc22a5 UTSW 11 53871616 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAATGTTCCTGGGCCACCTG -3'
(R):5'- TGGTATGTCCATCGTGTTCC -3'

Sequencing Primer
(F):5'- CTGACTGGAGGATGCTCATCAG -3'
(R):5'- GTCCATCGTGTTCCTGGCG -3'
Posted On2015-09-24