Incidental Mutation 'R4582:Brd9'
ID343751
Institutional Source Beutler Lab
Gene Symbol Brd9
Ensembl Gene ENSMUSG00000057649
Gene Namebromodomain containing 9
Synonyms
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73937811-73960895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73947733 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 366 (F366L)
Ref Sequence ENSEMBL: ENSMUSP00000152390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099384] [ENSMUST00000222399] [ENSMUST00000223238]
Predicted Effect probably benign
Transcript: ENSMUST00000099384
AA Change: F367L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096982
Gene: ENSMUSG00000057649
AA Change: F367L

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
coiled coil region 53 104 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
BROMO 134 242 1.52e-30 SMART
low complexity region 249 264 N/A INTRINSIC
Pfam:DUF3512 274 505 1.6e-82 PFAM
low complexity region 544 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222191
Predicted Effect probably benign
Transcript: ENSMUST00000222399
AA Change: F366L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000223238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223455
Predicted Effect unknown
Transcript: ENSMUST00000223525
AA Change: F301L
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Brd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Brd9 APN 13 73938547 missense probably damaging 0.98
IGL01461:Brd9 APN 13 73951598 nonsense probably null
IGL01928:Brd9 APN 13 73955511 missense probably benign 0.02
R0379:Brd9 UTSW 13 73942683 splice site probably benign
R0420:Brd9 UTSW 13 73955473 missense probably benign
R0788:Brd9 UTSW 13 73944867 splice site probably benign
R1539:Brd9 UTSW 13 73944743 missense probably damaging 0.99
R4095:Brd9 UTSW 13 73944799 missense probably benign 0.19
R4648:Brd9 UTSW 13 73940776 missense probably benign 0.37
R4915:Brd9 UTSW 13 73938455 missense probably damaging 0.99
R6054:Brd9 UTSW 13 73940741 missense probably damaging 1.00
R6175:Brd9 UTSW 13 73960314 missense probably damaging 0.98
R6462:Brd9 UTSW 13 73940669 missense probably damaging 1.00
R6520:Brd9 UTSW 13 73942794 missense probably benign 0.00
R7217:Brd9 UTSW 13 73938944 missense probably damaging 1.00
R7360:Brd9 UTSW 13 73944823 missense probably benign 0.07
R7422:Brd9 UTSW 13 73954578 missense probably benign
R7556:Brd9 UTSW 13 73944767 missense possibly damaging 0.83
R7844:Brd9 UTSW 13 73938533 missense probably damaging 1.00
Z1176:Brd9 UTSW 13 73944751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTATCGATGTCAAGGCAATTAC -3'
(R):5'- TCCACCTACTTTAATGGAGCTAAGC -3'

Sequencing Primer
(F):5'- CGATGTCAAGGCAATTACTGAATC -3'
(R):5'- TGCAGACTTGATGTACCCAG -3'
Posted On2015-09-24