Incidental Mutation 'R4582:Lima1'
ID343757
Institutional Source Beutler Lab
Gene Symbol Lima1
Ensembl Gene ENSMUSG00000023022
Gene NameLIM domain and actin binding 1
Synonyms3526402A12Rik, 1110021C24Rik, EPLIN, epithelial protein lost in neoplasm
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99778470-99875456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99780992 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 523 (T523A)
Ref Sequence ENSEMBL: ENSMUSP00000073371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073691] [ENSMUST00000109024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073691
AA Change: T523A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073371
Gene: ENSMUSG00000023022
AA Change: T523A

DomainStartEndE-ValueType
LIM 387 439 5.14e-17 SMART
low complexity region 534 546 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 747 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109024
AA Change: T363A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104652
Gene: ENSMUSG00000023022
AA Change: T363A

DomainStartEndE-ValueType
LIM 227 279 5.14e-17 SMART
low complexity region 374 386 N/A INTRINSIC
low complexity region 410 427 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
low complexity region 587 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172119
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that inhibits actin filament depolymerization and cross-links filaments in bundles. It is downregulated in some cancer cell lines. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and expression of some of the variants maybe independently regulated. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Lima1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Lima1 APN 15 99802157 missense possibly damaging 0.47
IGL01104:Lima1 APN 15 99843700 missense probably damaging 1.00
IGL02618:Lima1 APN 15 99802216 splice site probably benign
IGL03124:Lima1 APN 15 99796734 splice site probably benign
R0312:Lima1 UTSW 15 99781087 missense possibly damaging 0.69
R0599:Lima1 UTSW 15 99802159 missense probably damaging 1.00
R0601:Lima1 UTSW 15 99780472 missense probably damaging 0.98
R1423:Lima1 UTSW 15 99819745 nonsense probably null
R1704:Lima1 UTSW 15 99819736 missense probably benign 0.00
R1784:Lima1 UTSW 15 99780463 missense possibly damaging 0.93
R1819:Lima1 UTSW 15 99819936 missense probably benign 0.01
R1968:Lima1 UTSW 15 99819684 missense probably benign
R2352:Lima1 UTSW 15 99794515 missense probably benign 0.02
R2908:Lima1 UTSW 15 99802110 critical splice donor site probably null
R4672:Lima1 UTSW 15 99843709 missense probably damaging 1.00
R4858:Lima1 UTSW 15 99819576 missense probably benign 0.23
R6140:Lima1 UTSW 15 99781058 missense probably damaging 1.00
R6614:Lima1 UTSW 15 99783580 missense probably damaging 1.00
R6898:Lima1 UTSW 15 99781267 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCGAAAGGAAGCTGCTACCG -3'
(R):5'- ATCTGTGGGCAAGCAAGAGC -3'

Sequencing Primer
(F):5'- TCTCCTTCAGGGACGAAGAC -3'
(R):5'- GCGACAATGAGGAGACTTTGG -3'
Posted On2015-09-24