Incidental Mutation 'R4582:Man2a1'
ID343759
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R4582 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64752499 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1127 (A1127V)
Ref Sequence ENSEMBL: ENSMUSP00000083928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723] [ENSMUST00000169668]
Predicted Effect probably benign
Transcript: ENSMUST00000086723
AA Change: A1127V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: A1127V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169668
SMART Domains Protein: ENSMUSP00000130529
Gene: ENSMUSG00000024085

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38C 1 268 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170636
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1599:Man2a1 UTSW 17 64679831 missense possibly damaging 0.80
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5229:Man2a1 UTSW 17 64710734 missense probably benign 0.00
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5273:Man2a1 UTSW 17 64733785 missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64651227 missense probably damaging 0.99
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5942:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6245:Man2a1 UTSW 17 64710826 missense probably damaging 0.97
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
R7354:Man2a1 UTSW 17 64752544 missense probably damaging 1.00
R7833:Man2a1 UTSW 17 64666751 missense probably damaging 0.99
R7991:Man2a1 UTSW 17 64601776 missense probably benign 0.28
RF007:Man2a1 UTSW 17 64712253 missense probably damaging 0.98
Z1177:Man2a1 UTSW 17 64659020 missense probably damaging 1.00
Z1177:Man2a1 UTSW 17 64735054 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCTTCATGTTCTCAAAAGG -3'
(R):5'- TGTTCTCACAGTAGCCAGAAG -3'

Sequencing Primer
(F):5'- GTTTATAGATGTGCTAGGAGTCTCCC -3'
(R):5'- CCAGAAGCTAAAGTAATGTGCTTAG -3'
Posted On2015-09-24