Mutagenetix > Incidental Mutation

Incidental Mutation 'R0058:Slc15a2'

34376

Institutional Source

Beutler Lab

Gene Symbol

Slc15a2

Ensembl Gene

ENSMUSG00000022899

Gene Name

solute carrier family 15 (H+/peptide transporter), member 2

Synonyms

8430408C16Rik, Pept2

MMRRC Submission

038352-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R0058 (G1)

Quality Score

209

Status

Validated

Chromosome

Chromosomal Location

36750177-36784962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36754547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 531 (I531T)

Ref Sequence

ENSEMBL: ENSMUSP00000023616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023616
AA Change: I531T

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: I531T

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	122	500	1.7e-122	PFAM
Pfam:PTR2	593	686	2.5e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163964

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164770

Predicted Effect

probably benign
Transcript: ENSMUST00000165380

SMART Domains

Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165531
AA Change: I500T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: I500T

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	99	469	2.4e-105	PFAM
PDB:2XUT\|C	583	642	3e-10	PDB
transmembrane domain	655	677	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167941

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172382

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ache	T	G	5: 137,290,842	V270G	probably damaging	Het
Acss1	A	T	2: 150,628,539	W394R	probably damaging	Het
Adgrv1	A	G	13: 81,182,672	V6088A	possibly damaging	Het
Ankrd36	A	G	11: 5,630,691		probably benign	Het
Anxa1	A	T	19: 20,383,777	Y84N	probably damaging	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Avpr1b	A	G	1: 131,599,786	T16A	probably benign	Het
Bpifb1	G	A	2: 154,206,540	R165H	possibly damaging	Het
Cables1	A	G	18: 11,923,413	E316G	possibly damaging	Het
Cadm1	A	T	9: 47,850,331	I427L	probably damaging	Het
Ccdc97	T	C	7: 25,715,980	D86G	probably benign	Het
Cgnl1	C	A	9: 71,641,397	D1081Y	probably damaging	Het
Cgnl1	T	A	9: 71,724,840	R410W	probably damaging	Het
Cntnap4	G	A	8: 112,785,784	E593K	probably damaging	Het
Dazap1	T	C	10: 80,261,581		probably benign	Het
Dip2b	A	G	15: 100,215,240	E1512G	probably benign	Het
Dock1	G	A	7: 135,108,761	V1171M	possibly damaging	Het
Dock5	A	T	14: 67,781,036	F1230Y	probably benign	Het
Dym	G	A	18: 75,043,172	E15K	possibly damaging	Het
Ednra	C	A	8: 77,667,322		probably null	Het
Faf1	A	G	4: 109,736,624	Q133R	probably benign	Het
Fbxw28	A	G	9: 109,328,211	I323T	probably benign	Het
Fcer2a	T	C	8: 3,688,111		probably benign	Het
Fmo2	A	T	1: 162,886,324	S204R	probably benign	Het
Frmd4b	A	G	6: 97,423,499	V63A	probably damaging	Het
Fzd8	G	A	18: 9,213,985	A356T	possibly damaging	Het
Ghitm	A	G	14: 37,131,592	L97P	probably damaging	Het
Gins4	A	G	8: 23,229,510		probably benign	Het
Golga3	T	A	5: 110,202,777	F766Y	possibly damaging	Het
Hapln1	T	C	13: 89,607,878	I267T	probably benign	Het
Helz	A	T	11: 107,672,558		probably benign	Het
Herc2	T	C	7: 56,170,483	V2851A	possibly damaging	Het
Igkv8-18	G	A	6: 70,356,121		probably benign	Het
Igll1	A	T	16: 16,863,876	V5E	probably benign	Het
Irx3	T	C	8: 91,800,540	T179A	possibly damaging	Het
Kif16b	A	G	2: 142,857,305		probably null	Het
Limk1	A	T	5: 134,659,871	W507R	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Mtif3	C	A	5: 146,956,921	V159F	probably benign	Het
Myh6	C	T	14: 54,963,404	R169Q	probably damaging	Het
Ncoa7	T	A	10: 30,647,541	D887V	probably damaging	Het
Obox7	C	T	7: 14,664,388	P76S	probably benign	Het
Olfr1335	A	G	4: 118,809,480	M128T	probably benign	Het
Olfr323	A	T	11: 58,625,668	I126N	probably damaging	Het
Pitpnm2	G	A	5: 124,124,030	A862V	probably damaging	Het
Pkd1	G	C	17: 24,564,703	A162P	probably benign	Het
Plce1	A	G	19: 38,525,184	D309G	possibly damaging	Het
Plk4	T	C	3: 40,805,872	V401A	probably benign	Het
Prdx3	T	C	19: 60,874,512		probably benign	Het
Prrc2c	C	T	1: 162,698,884	V253I	unknown	Het
Ranbp2	T	A	10: 58,480,531	S2358T	probably damaging	Het
Setd2	T	A	9: 110,594,426	V2183E	probably damaging	Het
Sgsm1	T	A	5: 113,285,087	S232C	probably damaging	Het
Skint6	A	T	4: 113,046,815		probably benign	Het
Slc36a1	C	T	11: 55,221,994		probably benign	Het
Sorbs2	C	A	8: 45,796,263	D831E	probably damaging	Het
Sorbs2	T	A	8: 45,785,254		probably null	Het
Sptan1	T	C	2: 29,993,696		probably null	Het
Stam	T	C	2: 14,138,141	C336R	probably damaging	Het
Stil	G	T	4: 115,041,298	A1042S	probably damaging	Het
Stxbp5l	T	A	16: 37,142,374	D773V	possibly damaging	Het
Sugct	A	T	13: 17,672,581	L39Q	probably damaging	Het
Tep1	A	G	14: 50,834,065	V2041A	possibly damaging	Het
Tex15	C	T	8: 33,581,502		probably benign	Het
Tlr9	T	G	9: 106,224,965	L485R	possibly damaging	Het
Tmem207	A	G	16: 26,524,829		probably benign	Het
Triml2	T	C	8: 43,185,269		probably benign	Het
Trip6	A	G	5: 137,310,845		probably benign	Het
Tspear	T	C	10: 77,869,631	F288L	probably benign	Het
Vmn1r179	C	T	7: 23,929,167	T261I	possibly damaging	Het
Zfp644	A	T	5: 106,637,003	S559R	possibly damaging	Het

Other mutations in Slc15a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Slc15a2	APN	16	36753775	missense	probably benign	0.00
IGL00703:Slc15a2	APN	16	36757791	missense	probably benign	0.00
IGL00937:Slc15a2	APN	16	36751880	nonsense	probably null
IGL01511:Slc15a2	APN	16	36784726	missense	probably damaging	0.99
IGL01739:Slc15a2	APN	16	36756230	missense	probably benign
IGL02069:Slc15a2	APN	16	36759251	missense	probably benign	0.02
IGL02076:Slc15a2	APN	16	36762381	missense	probably damaging	1.00
IGL02254:Slc15a2	APN	16	36760087	missense	possibly damaging	0.93
IGL02387:Slc15a2	APN	16	36751775	splice site	probably null
IGL02507:Slc15a2	APN	16	36781659	missense	possibly damaging	0.87
IGL02829:Slc15a2	APN	16	36757193	missense	possibly damaging	0.92
IGL03114:Slc15a2	APN	16	36751905	missense	probably damaging	1.00
IGL03227:Slc15a2	APN	16	36756048	critical splice donor site	probably null
PIT4581001:Slc15a2	UTSW	16	36772043	missense	probably benign
R0058:Slc15a2	UTSW	16	36754547	missense	probably benign	0.08
R0083:Slc15a2	UTSW	16	36782283	missense	probably damaging	1.00
R0099:Slc15a2	UTSW	16	36753036	missense	probably damaging	1.00
R0104:Slc15a2	UTSW	16	36774635	missense	possibly damaging	0.79
R0402:Slc15a2	UTSW	16	36775598	missense	probably benign	0.00
R0619:Slc15a2	UTSW	16	36759307	missense	probably damaging	1.00
R0963:Slc15a2	UTSW	16	36774573	missense	probably damaging	1.00
R0972:Slc15a2	UTSW	16	36757139	missense	probably benign	0.00
R1440:Slc15a2	UTSW	16	36784643	splice site	probably benign
R1471:Slc15a2	UTSW	16	36753791	missense	probably damaging	0.99
R1569:Slc15a2	UTSW	16	36756383	missense	probably benign	0.00
R1616:Slc15a2	UTSW	16	36754481	missense	probably benign
R2246:Slc15a2	UTSW	16	36762361	missense	probably damaging	1.00
R2405:Slc15a2	UTSW	16	36751837	nonsense	probably null
R3834:Slc15a2	UTSW	16	36772128	nonsense	probably null
R3835:Slc15a2	UTSW	16	36772128	nonsense	probably null
R3885:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3887:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3888:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3889:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R4105:Slc15a2	UTSW	16	36782393	intron	probably benign
R4108:Slc15a2	UTSW	16	36782393	intron	probably benign
R4254:Slc15a2	UTSW	16	36754490	missense	probably benign	0.04
R4352:Slc15a2	UTSW	16	36772028	missense	probably benign	0.08
R4684:Slc15a2	UTSW	16	36757849	missense	probably damaging	1.00
R4747:Slc15a2	UTSW	16	36772136	missense	probably damaging	0.98
R4774:Slc15a2	UTSW	16	36781695	nonsense	probably null
R5151:Slc15a2	UTSW	16	36752297	missense	probably damaging	1.00
R5503:Slc15a2	UTSW	16	36762385	missense	probably damaging	1.00
R5649:Slc15a2	UTSW	16	36772110	nonsense	probably null
R6003:Slc15a2	UTSW	16	36754548	missense	probably benign	0.00
R6261:Slc15a2	UTSW	16	36761611	missense	probably benign	0.25
R6329:Slc15a2	UTSW	16	36751782	missense	possibly damaging	0.94
R6409:Slc15a2	UTSW	16	36761870	missense	probably benign	0.00
R6523:Slc15a2	UTSW	16	36752321	missense	probably benign	0.17
R7125:Slc15a2	UTSW	16	36782298	missense	probably damaging	1.00
R7208:Slc15a2	UTSW	16	36756281	missense	probably benign	0.02
R7234:Slc15a2	UTSW	16	36757811	missense	probably benign	0.05
R7374:Slc15a2	UTSW	16	36751845	missense	probably benign	0.01
R7545:Slc15a2	UTSW	16	36775602	missense	probably damaging	1.00
R7559:Slc15a2	UTSW	16	36751897	missense	probably benign
R7611:Slc15a2	UTSW	16	36756311	missense	probably benign	0.18
R7787:Slc15a2	UTSW	16	36751866	missense	probably benign	0.02
R7825:Slc15a2	UTSW	16	36753034	missense	possibly damaging	0.94
R8324:Slc15a2	UTSW	16	36759307	missense	probably damaging	1.00
R9035:Slc15a2	UTSW	16	36782357	missense	possibly damaging	0.82
R9037:Slc15a2	UTSW	16	36762363	missense	probably benign	0.11
R9212:Slc15a2	UTSW	16	36781691	nonsense	probably null
R9273:Slc15a2	UTSW	16	36753728	missense	probably benign	0.01
R9363:Slc15a2	UTSW	16	36752310	missense	possibly damaging	0.91
R9368:Slc15a2	UTSW	16	36753718	missense	probably benign	0.00
R9488:Slc15a2	UTSW	16	36759289	missense	probably benign	0.02
T0722:Slc15a2	UTSW	16	36772445	missense	probably benign
V8831:Slc15a2	UTSW	16	36772445	missense	probably benign
X0066:Slc15a2	UTSW	16	36753789	nonsense	probably null
Z1088:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1176:Slc15a2	UTSW	16	36759316	critical splice acceptor site	probably null
Z1176:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1177:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1177:Slc15a2	UTSW	16	36784687	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CGTCACAGAGGTGGGCTGTATTAAC -3'
(R):5'- AGGAAAGTCAGATTGCCATGTGTGTC -3'

Sequencing Primer
(F):5'- GTCTCAGCTACCAGTGTAGAAATCAG -3'
(R):5'- AGATTGCCATGTGTGTCTTTCC -3'

Posted On

2013-05-09