Incidental Mutation 'R0058:Slc15a2'
ID 34376
Institutional Source Beutler Lab
Gene Symbol Slc15a2
Ensembl Gene ENSMUSG00000022899
Gene Name solute carrier family 15 (H+/peptide transporter), member 2
Synonyms Pept2, 8430408C16Rik
MMRRC Submission 038352-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R0058 (G1)
Quality Score 209
Status Validated
Chromosome 16
Chromosomal Location 36570539-36605324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36574909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 531 (I531T)
Ref Sequence ENSEMBL: ENSMUSP00000023616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000165380] [ENSMUST00000165531]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023616
AA Change: I531T

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: I531T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 122 500 1.7e-122 PFAM
Pfam:PTR2 593 686 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164770
Predicted Effect probably benign
Transcript: ENSMUST00000165380
SMART Domains Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165531
AA Change: I500T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: I500T

DomainStartEndE-ValueType
low complexity region 35 47 N/A INTRINSIC
Pfam:PTR2 99 469 2.4e-105 PFAM
PDB:2XUT|C 583 642 3e-10 PDB
transmembrane domain 655 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167941
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,289,104 (GRCm39) V270G probably damaging Het
Acss1 A T 2: 150,470,459 (GRCm39) W394R probably damaging Het
Adgrv1 A G 13: 81,330,791 (GRCm39) V6088A possibly damaging Het
Ankrd36 A G 11: 5,580,691 (GRCm39) probably benign Het
Anxa1 A T 19: 20,361,141 (GRCm39) Y84N probably damaging Het
Arnt2 G A 7: 83,996,738 (GRCm39) R63C probably damaging Het
Avpr1b A G 1: 131,527,524 (GRCm39) T16A probably benign Het
Bpifb1 G A 2: 154,048,460 (GRCm39) R165H possibly damaging Het
Cables1 A G 18: 12,056,470 (GRCm39) E316G possibly damaging Het
Cadm1 A T 9: 47,761,629 (GRCm39) I427L probably damaging Het
Ccdc97 T C 7: 25,415,405 (GRCm39) D86G probably benign Het
Cgnl1 C A 9: 71,548,679 (GRCm39) D1081Y probably damaging Het
Cgnl1 T A 9: 71,632,122 (GRCm39) R410W probably damaging Het
Cntnap4 G A 8: 113,512,416 (GRCm39) E593K probably damaging Het
Dazap1 T C 10: 80,097,415 (GRCm39) probably benign Het
Dip2b A G 15: 100,113,121 (GRCm39) E1512G probably benign Het
Dock1 G A 7: 134,710,490 (GRCm39) V1171M possibly damaging Het
Dock5 A T 14: 68,018,485 (GRCm39) F1230Y probably benign Het
Dym G A 18: 75,176,243 (GRCm39) E15K possibly damaging Het
Ednra C A 8: 78,393,951 (GRCm39) probably null Het
Faf1 A G 4: 109,593,821 (GRCm39) Q133R probably benign Het
Fbxw28 A G 9: 109,157,279 (GRCm39) I323T probably benign Het
Fcer2a T C 8: 3,738,111 (GRCm39) probably benign Het
Fmo2 A T 1: 162,713,893 (GRCm39) S204R probably benign Het
Frmd4b A G 6: 97,400,460 (GRCm39) V63A probably damaging Het
Fzd8 G A 18: 9,213,985 (GRCm39) A356T possibly damaging Het
Ghitm A G 14: 36,853,549 (GRCm39) L97P probably damaging Het
Gins4 A G 8: 23,719,526 (GRCm39) probably benign Het
Golga3 T A 5: 110,350,643 (GRCm39) F766Y possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Helz A T 11: 107,563,384 (GRCm39) probably benign Het
Herc2 T C 7: 55,820,231 (GRCm39) V2851A possibly damaging Het
Igkv8-18 G A 6: 70,333,105 (GRCm39) probably benign Het
Igll1 A T 16: 16,681,740 (GRCm39) V5E probably benign Het
Irx3 T C 8: 92,527,168 (GRCm39) T179A possibly damaging Het
Kif16b A G 2: 142,699,225 (GRCm39) probably null Het
Limk1 A T 5: 134,688,725 (GRCm39) W507R probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mtif3 C A 5: 146,893,731 (GRCm39) V159F probably benign Het
Myh6 C T 14: 55,200,861 (GRCm39) R169Q probably damaging Het
Ncoa7 T A 10: 30,523,537 (GRCm39) D887V probably damaging Het
Obox7 C T 7: 14,398,313 (GRCm39) P76S probably benign Het
Or10ak12 A G 4: 118,666,677 (GRCm39) M128T probably benign Het
Or11l3 A T 11: 58,516,494 (GRCm39) I126N probably damaging Het
Pitpnm2 G A 5: 124,262,093 (GRCm39) A862V probably damaging Het
Pkd1 G C 17: 24,783,677 (GRCm39) A162P probably benign Het
Plce1 A G 19: 38,513,628 (GRCm39) D309G possibly damaging Het
Plk4 T C 3: 40,760,307 (GRCm39) V401A probably benign Het
Prdx3 T C 19: 60,862,950 (GRCm39) probably benign Het
Prrc2c C T 1: 162,526,453 (GRCm39) V253I unknown Het
Ranbp2 T A 10: 58,316,353 (GRCm39) S2358T probably damaging Het
Setd2 T A 9: 110,423,494 (GRCm39) V2183E probably damaging Het
Sgsm1 T A 5: 113,432,953 (GRCm39) S232C probably damaging Het
Skint6 A T 4: 112,904,012 (GRCm39) probably benign Het
Slc36a1 C T 11: 55,112,820 (GRCm39) probably benign Het
Sorbs2 C A 8: 46,249,300 (GRCm39) D831E probably damaging Het
Sorbs2 T A 8: 46,238,291 (GRCm39) probably null Het
Sptan1 T C 2: 29,883,708 (GRCm39) probably null Het
Stam T C 2: 14,142,952 (GRCm39) C336R probably damaging Het
Stil G T 4: 114,898,495 (GRCm39) A1042S probably damaging Het
Stxbp5l T A 16: 36,962,736 (GRCm39) D773V possibly damaging Het
Sugct A T 13: 17,847,166 (GRCm39) L39Q probably damaging Het
Tep1 A G 14: 51,071,522 (GRCm39) V2041A possibly damaging Het
Tex15 C T 8: 34,071,530 (GRCm39) probably benign Het
Tlr9 T G 9: 106,102,164 (GRCm39) L485R possibly damaging Het
Tmem207 A G 16: 26,343,579 (GRCm39) probably benign Het
Triml2 T C 8: 43,638,306 (GRCm39) probably benign Het
Trip6 A G 5: 137,309,107 (GRCm39) probably benign Het
Tspear T C 10: 77,705,465 (GRCm39) F288L probably benign Het
Vmn1r179 C T 7: 23,628,592 (GRCm39) T261I possibly damaging Het
Zfp644 A T 5: 106,784,869 (GRCm39) S559R possibly damaging Het
Other mutations in Slc15a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Slc15a2 APN 16 36,574,137 (GRCm39) missense probably benign 0.00
IGL00703:Slc15a2 APN 16 36,578,153 (GRCm39) missense probably benign 0.00
IGL00937:Slc15a2 APN 16 36,572,242 (GRCm39) nonsense probably null
IGL01511:Slc15a2 APN 16 36,605,088 (GRCm39) missense probably damaging 0.99
IGL01739:Slc15a2 APN 16 36,576,592 (GRCm39) missense probably benign
IGL02069:Slc15a2 APN 16 36,579,613 (GRCm39) missense probably benign 0.02
IGL02076:Slc15a2 APN 16 36,582,743 (GRCm39) missense probably damaging 1.00
IGL02254:Slc15a2 APN 16 36,580,449 (GRCm39) missense possibly damaging 0.93
IGL02387:Slc15a2 APN 16 36,572,137 (GRCm39) splice site probably null
IGL02507:Slc15a2 APN 16 36,602,021 (GRCm39) missense possibly damaging 0.87
IGL02829:Slc15a2 APN 16 36,577,555 (GRCm39) missense possibly damaging 0.92
IGL03114:Slc15a2 APN 16 36,572,267 (GRCm39) missense probably damaging 1.00
IGL03227:Slc15a2 APN 16 36,576,410 (GRCm39) critical splice donor site probably null
PIT4581001:Slc15a2 UTSW 16 36,592,405 (GRCm39) missense probably benign
R0058:Slc15a2 UTSW 16 36,574,909 (GRCm39) missense probably benign 0.08
R0083:Slc15a2 UTSW 16 36,602,645 (GRCm39) missense probably damaging 1.00
R0099:Slc15a2 UTSW 16 36,573,398 (GRCm39) missense probably damaging 1.00
R0104:Slc15a2 UTSW 16 36,594,997 (GRCm39) missense possibly damaging 0.79
R0402:Slc15a2 UTSW 16 36,595,960 (GRCm39) missense probably benign 0.00
R0619:Slc15a2 UTSW 16 36,579,669 (GRCm39) missense probably damaging 1.00
R0963:Slc15a2 UTSW 16 36,594,935 (GRCm39) missense probably damaging 1.00
R0972:Slc15a2 UTSW 16 36,577,501 (GRCm39) missense probably benign 0.00
R1440:Slc15a2 UTSW 16 36,605,005 (GRCm39) splice site probably benign
R1471:Slc15a2 UTSW 16 36,574,153 (GRCm39) missense probably damaging 0.99
R1569:Slc15a2 UTSW 16 36,576,745 (GRCm39) missense probably benign 0.00
R1616:Slc15a2 UTSW 16 36,574,843 (GRCm39) missense probably benign
R2246:Slc15a2 UTSW 16 36,582,723 (GRCm39) missense probably damaging 1.00
R2405:Slc15a2 UTSW 16 36,572,199 (GRCm39) nonsense probably null
R3834:Slc15a2 UTSW 16 36,592,490 (GRCm39) nonsense probably null
R3835:Slc15a2 UTSW 16 36,592,490 (GRCm39) nonsense probably null
R3885:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R3887:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R3888:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R3889:Slc15a2 UTSW 16 36,602,666 (GRCm39) missense probably damaging 1.00
R4105:Slc15a2 UTSW 16 36,602,755 (GRCm39) intron probably benign
R4108:Slc15a2 UTSW 16 36,602,755 (GRCm39) intron probably benign
R4254:Slc15a2 UTSW 16 36,574,852 (GRCm39) missense probably benign 0.04
R4352:Slc15a2 UTSW 16 36,592,390 (GRCm39) missense probably benign 0.08
R4684:Slc15a2 UTSW 16 36,578,211 (GRCm39) missense probably damaging 1.00
R4747:Slc15a2 UTSW 16 36,592,498 (GRCm39) missense probably damaging 0.98
R4774:Slc15a2 UTSW 16 36,602,057 (GRCm39) nonsense probably null
R5151:Slc15a2 UTSW 16 36,572,659 (GRCm39) missense probably damaging 1.00
R5503:Slc15a2 UTSW 16 36,582,747 (GRCm39) missense probably damaging 1.00
R5649:Slc15a2 UTSW 16 36,592,472 (GRCm39) nonsense probably null
R6003:Slc15a2 UTSW 16 36,574,910 (GRCm39) missense probably benign 0.00
R6261:Slc15a2 UTSW 16 36,581,973 (GRCm39) missense probably benign 0.25
R6329:Slc15a2 UTSW 16 36,572,144 (GRCm39) missense possibly damaging 0.94
R6409:Slc15a2 UTSW 16 36,582,232 (GRCm39) missense probably benign 0.00
R6523:Slc15a2 UTSW 16 36,572,683 (GRCm39) missense probably benign 0.17
R7125:Slc15a2 UTSW 16 36,602,660 (GRCm39) missense probably damaging 1.00
R7208:Slc15a2 UTSW 16 36,576,643 (GRCm39) missense probably benign 0.02
R7234:Slc15a2 UTSW 16 36,578,173 (GRCm39) missense probably benign 0.05
R7374:Slc15a2 UTSW 16 36,572,207 (GRCm39) missense probably benign 0.01
R7545:Slc15a2 UTSW 16 36,595,964 (GRCm39) missense probably damaging 1.00
R7559:Slc15a2 UTSW 16 36,572,259 (GRCm39) missense probably benign
R7611:Slc15a2 UTSW 16 36,576,673 (GRCm39) missense probably benign 0.18
R7787:Slc15a2 UTSW 16 36,572,228 (GRCm39) missense probably benign 0.02
R7825:Slc15a2 UTSW 16 36,573,396 (GRCm39) missense possibly damaging 0.94
R8324:Slc15a2 UTSW 16 36,579,669 (GRCm39) missense probably damaging 1.00
R9035:Slc15a2 UTSW 16 36,602,719 (GRCm39) missense possibly damaging 0.82
R9037:Slc15a2 UTSW 16 36,582,725 (GRCm39) missense probably benign 0.11
R9212:Slc15a2 UTSW 16 36,602,053 (GRCm39) nonsense probably null
R9273:Slc15a2 UTSW 16 36,574,090 (GRCm39) missense probably benign 0.01
R9363:Slc15a2 UTSW 16 36,572,672 (GRCm39) missense possibly damaging 0.91
R9368:Slc15a2 UTSW 16 36,574,080 (GRCm39) missense probably benign 0.00
R9488:Slc15a2 UTSW 16 36,579,651 (GRCm39) missense probably benign 0.02
T0722:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
V8831:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
X0066:Slc15a2 UTSW 16 36,574,151 (GRCm39) nonsense probably null
Z1088:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
Z1176:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
Z1176:Slc15a2 UTSW 16 36,579,678 (GRCm39) critical splice acceptor site probably null
Z1177:Slc15a2 UTSW 16 36,605,049 (GRCm39) frame shift probably null
Z1177:Slc15a2 UTSW 16 36,772,445 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTCACAGAGGTGGGCTGTATTAAC -3'
(R):5'- AGGAAAGTCAGATTGCCATGTGTGTC -3'

Sequencing Primer
(F):5'- GTCTCAGCTACCAGTGTAGAAATCAG -3'
(R):5'- AGATTGCCATGTGTGTCTTTCC -3'
Posted On 2013-05-09