Incidental Mutation 'R4582:Taf1'
List |< first << previous [record 34 of 43] next >> last >|
ID343762
Institutional Source Beutler Lab
Gene Symbol Taf1
Ensembl Gene ENSMUSG00000031314
Gene NameTATA-box binding protein associated factor 1
SynonymsTaf2a, KAT4, Ccg-1, B430306D02Rik, Ccg1
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4582 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location101532734-101601789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101593995 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1696 (V1696A)
Ref Sequence ENSEMBL: ENSMUSP00000098895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101341] [ENSMUST00000118878] [ENSMUST00000143908] [ENSMUST00000149274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101341
AA Change: V1696A

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098895
Gene: ENSMUSG00000031314
AA Change: V1696A

DomainStartEndE-ValueType
Pfam:TBP-binding 23 86 3.1e-25 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 259 267 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Pfam:DUF3591 592 1055 6.7e-171 PFAM
low complexity region 1111 1123 N/A INTRINSIC
coiled coil region 1132 1168 N/A INTRINSIC
coiled coil region 1244 1277 N/A INTRINSIC
Pfam:zf-CCHC_6 1293 1332 1e-18 PFAM
low complexity region 1373 1390 N/A INTRINSIC
BROMO 1410 1518 6.27e-32 SMART
BROMO 1532 1641 1.42e-39 SMART
low complexity region 1655 1666 N/A INTRINSIC
low complexity region 1668 1679 N/A INTRINSIC
low complexity region 1720 1734 N/A INTRINSIC
low complexity region 1751 1767 N/A INTRINSIC
low complexity region 1775 1789 N/A INTRINSIC
low complexity region 1856 1866 N/A INTRINSIC
low complexity region 1880 1888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118878
AA Change: V1664A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112772
Gene: ENSMUSG00000031314
AA Change: V1664A

DomainStartEndE-ValueType
Pfam:TBP-binding 22 87 1.4e-26 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 259 267 N/A INTRINSIC
low complexity region 522 538 N/A INTRINSIC
Pfam:DUF3591 565 1028 5.1e-158 PFAM
low complexity region 1084 1096 N/A INTRINSIC
coiled coil region 1105 1136 N/A INTRINSIC
coiled coil region 1212 1245 N/A INTRINSIC
Pfam:zf-CCHC_6 1261 1300 1.2e-17 PFAM
low complexity region 1341 1358 N/A INTRINSIC
BROMO 1378 1486 6.27e-32 SMART
BROMO 1500 1609 1.42e-39 SMART
low complexity region 1623 1634 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1688 1702 N/A INTRINSIC
low complexity region 1719 1735 N/A INTRINSIC
low complexity region 1743 1757 N/A INTRINSIC
low complexity region 1824 1834 N/A INTRINSIC
low complexity region 1848 1856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140470
Predicted Effect probably benign
Transcript: ENSMUST00000143908
AA Change: V1685A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138159
Gene: ENSMUSG00000031314
AA Change: V1685A

DomainStartEndE-ValueType
Pfam:TBP-binding 22 87 3.1e-27 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 185 212 N/A INTRINSIC
low complexity region 280 288 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:DUF3591 586 1049 7.1e-159 PFAM
low complexity region 1105 1117 N/A INTRINSIC
coiled coil region 1126 1157 N/A INTRINSIC
coiled coil region 1233 1266 N/A INTRINSIC
Pfam:zf-CCHC_6 1282 1321 4.4e-18 PFAM
low complexity region 1362 1379 N/A INTRINSIC
BROMO 1399 1507 6.27e-32 SMART
BROMO 1521 1630 1.42e-39 SMART
low complexity region 1644 1655 N/A INTRINSIC
low complexity region 1657 1668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149274
AA Change: V1687A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114765
Gene: ENSMUSG00000031314
AA Change: V1687A

DomainStartEndE-ValueType
Pfam:TBP-binding 22 87 8.3e-28 PFAM
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 165 N/A INTRINSIC
low complexity region 185 212 N/A INTRINSIC
low complexity region 280 288 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:DUF3591 586 710 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211461
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is the basal transcription factor TFIID, which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes the largest subunit of TFIID. This subunit binds to core promoter sequences encompassing the transcription start site. It also binds to activators and other transcriptional regulators, and these interactions affect the rate of transcription initiation. This subunit contains two independent protein kinase domains at the N- and C-terminals, but also possesses acetyltransferase activity and can act as a ubiquitin-activating/conjugating enzyme. Mutations in this gene result in Dystonia 3, torsion, X-linked, a dystonia-parkinsonism disorder. Alternative splicing of this gene results in multiple transcript variants. This gene is part of a complex transcription unit (TAF1/DYT3), wherein some transcript variants share exons with TAF1 as well as additional downstream DYT3 exons. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Tmie T G 9: 110,873,797 E32A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Taf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Taf1 APN X 101562939 missense probably damaging 0.99
IGL01519:Taf1 APN X 101562806 splice site probably benign
R1768:Taf1 UTSW X 101540894 missense probably benign 0.37
R1867:Taf1 UTSW X 101562957 missense probably damaging 1.00
R4242:Taf1 UTSW X 101544503 missense probably benign
R4491:Taf1 UTSW X 101543059 missense possibly damaging 0.93
R4492:Taf1 UTSW X 101543059 missense possibly damaging 0.93
Z1176:Taf1 UTSW X 101596244 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATGCCAGTCTGCTAGAGTG -3'
(R):5'- GACTAAAGGATCCAGTCATTTTCC -3'

Sequencing Primer
(F):5'- ATTTGTGTAAAAAGCTGTACCGGGC -3'
(R):5'- TCCATATATACATGGGATCACTCCG -3'
Posted On2015-09-24