Incidental Mutation 'R0058:Cables1'
ID 34380
Institutional Source Beutler Lab
Gene Symbol Cables1
Ensembl Gene ENSMUSG00000040957
Gene Name CDK5 and Abl enzyme substrate 1
Synonyms ik3-1, interactor-1 with cdk3
MMRRC Submission 038352-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.620) question?
Stock # R0058 (G1)
Quality Score 205
Status Validated
Chromosome 18
Chromosomal Location 11972600-12078681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12056470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000040639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]
AlphaFold Q9ESJ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000046948
AA Change: E316G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957
AA Change: E316G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 456 544 1.83e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171109
AA Change: E342G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957
AA Change: E342G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 482 570 1.83e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225430
Meta Mutation Damage Score 0.2739 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache T G 5: 137,289,104 (GRCm39) V270G probably damaging Het
Acss1 A T 2: 150,470,459 (GRCm39) W394R probably damaging Het
Adgrv1 A G 13: 81,330,791 (GRCm39) V6088A possibly damaging Het
Ankrd36 A G 11: 5,580,691 (GRCm39) probably benign Het
Anxa1 A T 19: 20,361,141 (GRCm39) Y84N probably damaging Het
Arnt2 G A 7: 83,996,738 (GRCm39) R63C probably damaging Het
Avpr1b A G 1: 131,527,524 (GRCm39) T16A probably benign Het
Bpifb1 G A 2: 154,048,460 (GRCm39) R165H possibly damaging Het
Cadm1 A T 9: 47,761,629 (GRCm39) I427L probably damaging Het
Ccdc97 T C 7: 25,415,405 (GRCm39) D86G probably benign Het
Cgnl1 C A 9: 71,548,679 (GRCm39) D1081Y probably damaging Het
Cgnl1 T A 9: 71,632,122 (GRCm39) R410W probably damaging Het
Cntnap4 G A 8: 113,512,416 (GRCm39) E593K probably damaging Het
Dazap1 T C 10: 80,097,415 (GRCm39) probably benign Het
Dip2b A G 15: 100,113,121 (GRCm39) E1512G probably benign Het
Dock1 G A 7: 134,710,490 (GRCm39) V1171M possibly damaging Het
Dock5 A T 14: 68,018,485 (GRCm39) F1230Y probably benign Het
Dym G A 18: 75,176,243 (GRCm39) E15K possibly damaging Het
Ednra C A 8: 78,393,951 (GRCm39) probably null Het
Faf1 A G 4: 109,593,821 (GRCm39) Q133R probably benign Het
Fbxw28 A G 9: 109,157,279 (GRCm39) I323T probably benign Het
Fcer2a T C 8: 3,738,111 (GRCm39) probably benign Het
Fmo2 A T 1: 162,713,893 (GRCm39) S204R probably benign Het
Frmd4b A G 6: 97,400,460 (GRCm39) V63A probably damaging Het
Fzd8 G A 18: 9,213,985 (GRCm39) A356T possibly damaging Het
Ghitm A G 14: 36,853,549 (GRCm39) L97P probably damaging Het
Gins4 A G 8: 23,719,526 (GRCm39) probably benign Het
Golga3 T A 5: 110,350,643 (GRCm39) F766Y possibly damaging Het
Hapln1 T C 13: 89,755,997 (GRCm39) I267T probably benign Het
Helz A T 11: 107,563,384 (GRCm39) probably benign Het
Herc2 T C 7: 55,820,231 (GRCm39) V2851A possibly damaging Het
Igkv8-18 G A 6: 70,333,105 (GRCm39) probably benign Het
Igll1 A T 16: 16,681,740 (GRCm39) V5E probably benign Het
Irx3 T C 8: 92,527,168 (GRCm39) T179A possibly damaging Het
Kif16b A G 2: 142,699,225 (GRCm39) probably null Het
Limk1 A T 5: 134,688,725 (GRCm39) W507R probably damaging Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Mtif3 C A 5: 146,893,731 (GRCm39) V159F probably benign Het
Myh6 C T 14: 55,200,861 (GRCm39) R169Q probably damaging Het
Ncoa7 T A 10: 30,523,537 (GRCm39) D887V probably damaging Het
Obox7 C T 7: 14,398,313 (GRCm39) P76S probably benign Het
Or10ak12 A G 4: 118,666,677 (GRCm39) M128T probably benign Het
Or11l3 A T 11: 58,516,494 (GRCm39) I126N probably damaging Het
Pitpnm2 G A 5: 124,262,093 (GRCm39) A862V probably damaging Het
Pkd1 G C 17: 24,783,677 (GRCm39) A162P probably benign Het
Plce1 A G 19: 38,513,628 (GRCm39) D309G possibly damaging Het
Plk4 T C 3: 40,760,307 (GRCm39) V401A probably benign Het
Prdx3 T C 19: 60,862,950 (GRCm39) probably benign Het
Prrc2c C T 1: 162,526,453 (GRCm39) V253I unknown Het
Ranbp2 T A 10: 58,316,353 (GRCm39) S2358T probably damaging Het
Setd2 T A 9: 110,423,494 (GRCm39) V2183E probably damaging Het
Sgsm1 T A 5: 113,432,953 (GRCm39) S232C probably damaging Het
Skint6 A T 4: 112,904,012 (GRCm39) probably benign Het
Slc15a2 A G 16: 36,574,909 (GRCm39) I531T probably benign Het
Slc36a1 C T 11: 55,112,820 (GRCm39) probably benign Het
Sorbs2 C A 8: 46,249,300 (GRCm39) D831E probably damaging Het
Sorbs2 T A 8: 46,238,291 (GRCm39) probably null Het
Sptan1 T C 2: 29,883,708 (GRCm39) probably null Het
Stam T C 2: 14,142,952 (GRCm39) C336R probably damaging Het
Stil G T 4: 114,898,495 (GRCm39) A1042S probably damaging Het
Stxbp5l T A 16: 36,962,736 (GRCm39) D773V possibly damaging Het
Sugct A T 13: 17,847,166 (GRCm39) L39Q probably damaging Het
Tep1 A G 14: 51,071,522 (GRCm39) V2041A possibly damaging Het
Tex15 C T 8: 34,071,530 (GRCm39) probably benign Het
Tlr9 T G 9: 106,102,164 (GRCm39) L485R possibly damaging Het
Tmem207 A G 16: 26,343,579 (GRCm39) probably benign Het
Triml2 T C 8: 43,638,306 (GRCm39) probably benign Het
Trip6 A G 5: 137,309,107 (GRCm39) probably benign Het
Tspear T C 10: 77,705,465 (GRCm39) F288L probably benign Het
Vmn1r179 C T 7: 23,628,592 (GRCm39) T261I possibly damaging Het
Zfp644 A T 5: 106,784,869 (GRCm39) S559R possibly damaging Het
Other mutations in Cables1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Cables1 APN 18 12,077,621 (GRCm39) missense probably damaging 0.99
IGL01373:Cables1 APN 18 12,021,821 (GRCm39) missense probably damaging 0.98
R0058:Cables1 UTSW 18 12,056,470 (GRCm39) missense possibly damaging 0.80
R2886:Cables1 UTSW 18 12,072,789 (GRCm39) missense possibly damaging 0.80
R4691:Cables1 UTSW 18 11,973,580 (GRCm39) nonsense probably null
R4845:Cables1 UTSW 18 12,077,545 (GRCm39) missense probably damaging 0.99
R4964:Cables1 UTSW 18 12,074,334 (GRCm39) missense possibly damaging 0.92
R5286:Cables1 UTSW 18 12,057,884 (GRCm39) missense probably benign 0.11
R5756:Cables1 UTSW 18 12,074,410 (GRCm39) missense probably damaging 1.00
R6755:Cables1 UTSW 18 12,072,882 (GRCm39) missense probably null 1.00
R7162:Cables1 UTSW 18 12,059,423 (GRCm39) critical splice donor site probably null
R7242:Cables1 UTSW 18 11,973,064 (GRCm39) missense possibly damaging 0.93
R7410:Cables1 UTSW 18 12,074,282 (GRCm39) missense probably benign
R7411:Cables1 UTSW 18 11,973,572 (GRCm39) missense probably benign 0.01
R7965:Cables1 UTSW 18 11,973,269 (GRCm39) missense probably benign 0.06
R8765:Cables1 UTSW 18 12,056,422 (GRCm39) missense probably benign 0.01
R9167:Cables1 UTSW 18 12,039,029 (GRCm39) missense possibly damaging 0.95
Z1177:Cables1 UTSW 18 12,074,374 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAAGAAGGCAGCACTAGCTC -3'
(R):5'- TCAGCAGGTTTCTGTCTGCACAC -3'

Sequencing Primer
(F):5'- ACTGGTAACCAAGGGCTTC -3'
(R):5'- CTGTCTGCACACTGGTAGAG -3'
Posted On 2013-05-09