Incidental Mutation 'R4583:Apoe'
ID343821
Institutional Source Beutler Lab
Gene Symbol Apoe
Ensembl Gene ENSMUSG00000002985
Gene Nameapolipoprotein E
Synonyms
MMRRC Submission 041804-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4583 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19696109-19699188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19697498 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 65 (Q65K)
Ref Sequence ENSEMBL: ENSMUSP00000134429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000045035] [ENSMUST00000093552] [ENSMUST00000108451] [ENSMUST00000172808] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174191] [ENSMUST00000174355] [ENSMUST00000174710] [ENSMUST00000207978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003066
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032555
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045035
SMART Domains Protein: ENSMUSP00000045571
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 1.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093552
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108451
SMART Domains Protein: ENSMUSP00000104091
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 3.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167646
SMART Domains Protein: ENSMUSP00000132032
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 201 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172808
AA Change: Q54K

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985
AA Change: Q54K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172983
AA Change: Q65K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173739
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174064
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174144
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174191
AA Change: Q65K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174355
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174710
AA Change: Q65K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207525
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mutations at this locus cause diet-induced hypercholesterolemia and atherosclerosis. Homozygous null mutants also develop foam-cell rich deposits in proximal aorta, impaired blood-nerve and blood-brain barriers, and many xanthomatous lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,574,592 L86P unknown Het
Aimp1 C T 3: 132,677,047 E23K probably damaging Het
Ap2b1 A T 11: 83,397,779 N884I probably benign Het
Arhgef1 T A 7: 24,912,571 D93E probably benign Het
Arhgef12 G T 9: 42,977,662 T1085K probably damaging Het
Arid5a T C 1: 36,317,664 probably null Het
Atp9a A T 2: 168,689,360 probably null Het
Baz1a T C 12: 54,922,540 I635V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cckar T A 5: 53,699,782 M429L probably benign Het
Ccl3 A T 11: 83,648,338 L65Q probably benign Het
Ccr3 A G 9: 124,029,440 T271A probably benign Het
Cd8b1 T A 6: 71,326,097 I52N probably damaging Het
Cdh15 G A 8: 122,865,028 E551K probably damaging Het
Cdh17 A G 4: 11,810,466 K719R probably benign Het
Cfap43 T C 19: 47,837,216 R38G probably null Het
Chd6 T C 2: 161,014,194 E715G probably damaging Het
Cldn34b2 T A X: 155,125,629 R68* probably null Het
Col19a1 T G 1: 24,561,329 D44A unknown Het
Colgalt2 C T 1: 152,506,876 S493F probably damaging Het
Cr1l T C 1: 195,129,831 I99M probably damaging Het
Crybg1 T C 10: 43,997,620 E1164G probably damaging Het
Cym G T 3: 107,211,402 D367E probably damaging Het
Dennd2a G T 6: 39,522,842 T263K probably damaging Het
Dhx9 T A 1: 153,460,303 M869L probably damaging Het
Dnm2 A G 9: 21,504,446 H692R probably damaging Het
Ern1 A T 11: 106,407,205 S697T probably damaging Het
F12 G A 13: 55,421,130 T273I probably benign Het
Fam151b A T 13: 92,468,109 L124Q probably damaging Het
Fancg A G 4: 43,002,991 V622A probably benign Het
Fbxo2 T A 4: 148,164,899 N159K possibly damaging Het
Fgd2 C A 17: 29,367,078 T212K possibly damaging Het
Fhl3 T A 4: 124,707,549 D178E probably benign Het
Filip1 G T 9: 79,815,809 A1176D possibly damaging Het
Fndc1 T C 17: 7,739,249 Y1722C probably damaging Het
Frem3 T C 8: 80,613,514 V812A probably benign Het
Fsip2 A G 2: 82,978,673 I1779V probably benign Het
Gli2 C T 1: 118,842,068 V585I probably benign Het
Gm15056 C G 8: 20,900,681 S80T probably benign Het
Gm4951 T C 18: 60,246,080 I229T possibly damaging Het
Gm5145 A G 17: 20,570,453 E31G probably benign Het
Gmfg A G 7: 28,445,944 Y71C probably damaging Het
Grk1 A G 8: 13,409,322 E291G probably damaging Het
Gtpbp1 A G 15: 79,715,951 E393G possibly damaging Het
Gtpbp2 A G 17: 46,161,145 D2G probably damaging Het
Hc A T 2: 35,028,177 V698E probably benign Het
Helz G A 11: 107,646,069 R249H probably damaging Het
Hmcn2 A G 2: 31,413,265 I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,663,606 R286G probably benign Het
Hus1b A T 13: 30,947,518 W53R probably damaging Het
Hydin C T 8: 110,595,225 T4503I probably benign Het
Ighmbp2 G C 19: 3,265,324 P699A probably benign Het
Igkv1-122 A T 6: 68,017,458 Y110F probably benign Het
Igkv8-28 T C 6: 70,143,620 Y113C probably damaging Het
Il16 A G 7: 83,682,899 S158P probably damaging Het
Kalrn T A 16: 34,235,267 H876L probably damaging Het
Kdm5d T A Y: 914,134 L357H probably damaging Het
Krt78 T C 15: 101,946,620 T919A possibly damaging Het
L3mbtl2 T C 15: 81,684,906 C594R probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lgals3 A T 14: 47,381,687 probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lpcat3 T G 6: 124,703,323 W429G possibly damaging Het
Lrp1 T C 10: 127,541,372 T4149A probably benign Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Micalcl A G 7: 112,412,947 N668S probably benign Het
Ms4a10 A T 19: 10,968,189 I76N possibly damaging Het
Mthfr T G 4: 148,051,872 L362V possibly damaging Het
Myh3 T A 11: 67,096,453 Y1376* probably null Het
Mymk C A 2: 27,062,280 V192F probably benign Het
Myo1c A G 11: 75,671,862 D966G possibly damaging Het
Ncam2 A G 16: 81,517,557 N474D probably damaging Het
Nmnat1 T C 4: 149,469,151 N168S possibly damaging Het
Nmur1 C T 1: 86,386,645 V323M possibly damaging Het
Npr2 C A 4: 43,633,522 probably null Het
Nsd3 T A 8: 25,710,676 M1265K probably benign Het
Olfr1206 G T 2: 88,865,494 M296I probably benign Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1462 T A 19: 13,190,698 F10L probably damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr155 A G 4: 43,855,262 T318A probably benign Het
Olfr345 A C 2: 36,640,614 T192P probably damaging Het
Olfr394 T C 11: 73,887,803 T190A probably damaging Het
Olfr812 T C 10: 129,842,475 D189G probably damaging Het
Otub1 G A 19: 7,204,436 A25V possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl2 A G 2: 122,126,745 S103P probably benign Het
Pcdhb15 A T 18: 37,475,575 H620L possibly damaging Het
Pdgfc A T 3: 81,141,528 D81V possibly damaging Het
Pdia2 T C 17: 26,196,502 D447G probably damaging Het
Pold1 C A 7: 44,538,913 A514S probably damaging Het
Pomgnt1 C T 4: 116,158,494 T552I probably benign Het
Ppl T C 16: 5,104,536 E294G probably benign Het
Pramef8 A G 4: 143,416,754 Y30C probably damaging Het
Prkcb A G 7: 122,457,224 S100G probably benign Het
Psg16 T G 7: 17,095,172 I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 123,001,952 probably benign Het
Reck T C 4: 43,931,062 probably null Het
Rrbp1 C T 2: 143,988,751 G499S probably benign Het
Sema6d G T 2: 124,664,162 R630L probably damaging Het
Slc29a1 A G 17: 45,589,956 V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 Q324L probably benign Het
Slc35c1 A T 2: 92,458,921 L80Q probably damaging Het
Slc7a10 G T 7: 35,197,952 probably null Het
Srrm2 C T 17: 23,819,619 probably benign Het
Stk38 T G 17: 28,982,156 D182A probably damaging Het
Tas2r104 C T 6: 131,685,435 G104S probably benign Het
Tmem121b T C 6: 120,492,094 E554G probably damaging Het
Tor1aip2 A G 1: 156,065,142 H398R probably benign Het
Tram2 C T 1: 21,013,449 V83I probably benign Het
Ube3a C T 7: 59,286,063 T565I probably damaging Het
Ubr4 T C 4: 139,380,853 V56A possibly damaging Het
Vmn1r128 T C 7: 21,349,719 V116A possibly damaging Het
Vmn1r170 C T 7: 23,606,662 T163I probably benign Het
Vmn2r75 T A 7: 86,164,082 D504V possibly damaging Het
Vps36 G A 8: 22,218,420 M363I probably benign Het
Wdsub1 A G 2: 59,878,317 S71P probably damaging Het
Zdhhc12 A G 2: 30,091,484 F189L probably benign Het
Zfp521 T C 18: 13,844,330 M1009V probably benign Het
Other mutations in Apoe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Apoe APN 7 19696600 missense probably damaging 1.00
IGL03324:Apoe APN 7 19696537 missense probably benign 0.05
R0008:Apoe UTSW 7 19697080 missense probably damaging 0.99
R2860:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2861:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2862:Apoe UTSW 7 19697554 missense probably damaging 1.00
R3919:Apoe UTSW 7 19696547 missense probably benign 0.00
R4756:Apoe UTSW 7 19696921 missense probably benign 0.20
R5027:Apoe UTSW 7 19697015 missense probably damaging 1.00
R6188:Apoe UTSW 7 19698380 intron probably benign
R6464:Apoe UTSW 7 19697536 missense probably damaging 1.00
R7652:Apoe UTSW 7 19696610 missense possibly damaging 0.95
R8277:Apoe UTSW 7 19698378 intron probably benign
R8513:Apoe UTSW 7 19696640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTCCTCCATCAGTGCC -3'
(R):5'- GTCCTGACCCAGCCTTAAAC -3'

Sequencing Primer
(F):5'- TCGAAGCCAGCTTGAGTTAC -3'
(R):5'- CTTACTCTACACAGGATGCCTAG -3'
Posted On2015-09-24