Incidental Mutation 'R4583:Apoe'
ID 343821
Institutional Source Beutler Lab
Gene Symbol Apoe
Ensembl Gene ENSMUSG00000002985
Gene Name apolipoprotein E
Synonyms Apoe
MMRRC Submission 041804-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.242) question?
Stock # R4583 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 19430034-19433113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 19431423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 65 (Q65K)
Ref Sequence ENSEMBL: ENSMUSP00000134429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000045035] [ENSMUST00000093552] [ENSMUST00000108451] [ENSMUST00000172808] [ENSMUST00000174191] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174355] [ENSMUST00000174710] [ENSMUST00000207978]
AlphaFold P08226
Predicted Effect possibly damaging
Transcript: ENSMUST00000003066
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032555
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045035
SMART Domains Protein: ENSMUSP00000045571
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 1.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093552
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108451
SMART Domains Protein: ENSMUSP00000104091
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 3.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167646
SMART Domains Protein: ENSMUSP00000132032
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 201 1.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172808
AA Change: Q54K

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985
AA Change: Q54K

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174191
AA Change: Q65K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172983
AA Change: Q65K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173739
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174064
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174144
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174355
AA Change: Q65K

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174710
AA Change: Q65K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985
AA Change: Q65K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207525
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mutations at this locus cause diet-induced hypercholesterolemia and atherosclerosis. Homozygous null mutants also develop foam-cell rich deposits in proximal aorta, impaired blood-nerve and blood-brain barriers, and many xanthomatous lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,274,017 (GRCm39) L86P unknown Het
Aimp1 C T 3: 132,382,808 (GRCm39) E23K probably damaging Het
Ap2b1 A T 11: 83,288,605 (GRCm39) N884I probably benign Het
Arhgef1 T A 7: 24,611,996 (GRCm39) D93E probably benign Het
Arhgef12 G T 9: 42,888,958 (GRCm39) T1085K probably damaging Het
Arid5a T C 1: 36,356,745 (GRCm39) probably null Het
Atp9a A T 2: 168,531,280 (GRCm39) probably null Het
Baz1a T C 12: 54,969,325 (GRCm39) I635V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Cckar T A 5: 53,857,124 (GRCm39) M429L probably benign Het
Ccl3 A T 11: 83,539,164 (GRCm39) L65Q probably benign Het
Ccr3 A G 9: 123,829,477 (GRCm39) T271A probably benign Het
Cd8b1 T A 6: 71,303,081 (GRCm39) I52N probably damaging Het
Cdh15 G A 8: 123,591,767 (GRCm39) E551K probably damaging Het
Cdh17 A G 4: 11,810,466 (GRCm39) K719R probably benign Het
Cfap43 T C 19: 47,825,655 (GRCm39) R38G probably null Het
Chd6 T C 2: 160,856,114 (GRCm39) E715G probably damaging Het
Cldn34b2 T A X: 153,908,625 (GRCm39) R68* probably null Het
Col19a1 T G 1: 24,600,410 (GRCm39) D44A unknown Het
Colgalt2 C T 1: 152,382,627 (GRCm39) S493F probably damaging Het
Cr1l T C 1: 194,812,139 (GRCm39) I99M probably damaging Het
Crybg1 T C 10: 43,873,616 (GRCm39) E1164G probably damaging Het
Cym G T 3: 107,118,718 (GRCm39) D367E probably damaging Het
Dennd2a G T 6: 39,499,776 (GRCm39) T263K probably damaging Het
Dhx9 T A 1: 153,336,049 (GRCm39) M869L probably damaging Het
Dnm2 A G 9: 21,415,742 (GRCm39) H692R probably damaging Het
Ern1 A T 11: 106,298,031 (GRCm39) S697T probably damaging Het
F12 G A 13: 55,568,943 (GRCm39) T273I probably benign Het
Fam151b A T 13: 92,604,617 (GRCm39) L124Q probably damaging Het
Fancg A G 4: 43,002,991 (GRCm39) V622A probably benign Het
Fbxo2 T A 4: 148,249,356 (GRCm39) N159K possibly damaging Het
Fgd2 C A 17: 29,586,052 (GRCm39) T212K possibly damaging Het
Fhl3 T A 4: 124,601,342 (GRCm39) D178E probably benign Het
Filip1 G T 9: 79,723,091 (GRCm39) A1176D possibly damaging Het
Fndc1 T C 17: 7,958,081 (GRCm39) Y1722C probably damaging Het
Frem3 T C 8: 81,340,143 (GRCm39) V812A probably benign Het
Fsip2 A G 2: 82,809,017 (GRCm39) I1779V probably benign Het
Gli2 C T 1: 118,769,798 (GRCm39) V585I probably benign Het
Gm15056 C G 8: 21,390,697 (GRCm39) S80T probably benign Het
Gm5145 A G 17: 20,790,715 (GRCm39) E31G probably benign Het
Gmfg A G 7: 28,145,369 (GRCm39) Y71C probably damaging Het
Grk1 A G 8: 13,459,322 (GRCm39) E291G probably damaging Het
Gtpbp1 A G 15: 79,600,152 (GRCm39) E393G possibly damaging Het
Gtpbp2 A G 17: 46,472,071 (GRCm39) D2G probably damaging Het
Hc A T 2: 34,918,189 (GRCm39) V698E probably benign Het
Helz G A 11: 107,536,895 (GRCm39) R249H probably damaging Het
Hmcn2 A G 2: 31,303,277 (GRCm39) I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,493,950 (GRCm39) R286G probably benign Het
Hus1b A T 13: 31,131,501 (GRCm39) W53R probably damaging Het
Hydin C T 8: 111,321,857 (GRCm39) T4503I probably benign Het
Ighmbp2 G C 19: 3,315,324 (GRCm39) P699A probably benign Het
Igkv1-122 A T 6: 67,994,442 (GRCm39) Y110F probably benign Het
Igkv8-28 T C 6: 70,120,604 (GRCm39) Y113C probably damaging Het
Iigp1c T C 18: 60,379,152 (GRCm39) I229T possibly damaging Het
Il16 A G 7: 83,332,107 (GRCm39) S158P probably damaging Het
Kalrn T A 16: 34,055,637 (GRCm39) H876L probably damaging Het
Kdm5d T A Y: 914,134 (GRCm39) L357H probably damaging Het
Krt78 T C 15: 101,855,055 (GRCm39) T919A possibly damaging Het
L3mbtl2 T C 15: 81,569,107 (GRCm39) C594R probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lgals3 A T 14: 47,619,144 (GRCm39) probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lpcat3 T G 6: 124,680,286 (GRCm39) W429G possibly damaging Het
Lrp1 T C 10: 127,377,241 (GRCm39) T4149A probably benign Het
Memo1 G A 17: 74,565,456 (GRCm39) Q36* probably null Het
Mical2 A G 7: 112,012,154 (GRCm39) N668S probably benign Het
Ms4a10 A T 19: 10,945,553 (GRCm39) I76N possibly damaging Het
Mthfr T G 4: 148,136,329 (GRCm39) L362V possibly damaging Het
Myh3 T A 11: 66,987,279 (GRCm39) Y1376* probably null Het
Mymk C A 2: 26,952,292 (GRCm39) V192F probably benign Het
Myo1c A G 11: 75,562,688 (GRCm39) D966G possibly damaging Het
Ncam2 A G 16: 81,314,445 (GRCm39) N474D probably damaging Het
Nmnat1 T C 4: 149,553,608 (GRCm39) N168S possibly damaging Het
Nmur1 C T 1: 86,314,367 (GRCm39) V323M possibly damaging Het
Npr2 C A 4: 43,633,522 (GRCm39) probably null Het
Nsd3 T A 8: 26,200,703 (GRCm39) M1265K probably benign Het
Or13c7 A G 4: 43,855,262 (GRCm39) T318A probably benign Het
Or1e34 T C 11: 73,778,629 (GRCm39) T190A probably damaging Het
Or1j16 A C 2: 36,530,626 (GRCm39) T192P probably damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or4c11 G T 2: 88,695,838 (GRCm39) M296I probably benign Het
Or5b108 T A 19: 13,168,062 (GRCm39) F10L probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Or6c216 T C 10: 129,678,344 (GRCm39) D189G probably damaging Het
Otub1 G A 19: 7,181,801 (GRCm39) A25V possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl2 A G 2: 121,957,226 (GRCm39) S103P probably benign Het
Pcdhb15 A T 18: 37,608,628 (GRCm39) H620L possibly damaging Het
Pdgfc A T 3: 81,048,835 (GRCm39) D81V possibly damaging Het
Pdia2 T C 17: 26,415,476 (GRCm39) D447G probably damaging Het
Pold1 C A 7: 44,188,337 (GRCm39) A514S probably damaging Het
Pomgnt1 C T 4: 116,015,691 (GRCm39) T552I probably benign Het
Ppl T C 16: 4,922,400 (GRCm39) E294G probably benign Het
Pramel12 A G 4: 143,143,324 (GRCm39) Y30C probably damaging Het
Prkcb A G 7: 122,056,447 (GRCm39) S100G probably benign Het
Psg16 T G 7: 16,829,097 (GRCm39) I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 122,601,175 (GRCm39) probably benign Het
Reck T C 4: 43,931,062 (GRCm39) probably null Het
Rrbp1 C T 2: 143,830,671 (GRCm39) G499S probably benign Het
Sema6d G T 2: 124,506,082 (GRCm39) R630L probably damaging Het
Slc29a1 A G 17: 45,900,882 (GRCm39) V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 (GRCm39) Q324L probably benign Het
Slc35c1 A T 2: 92,289,266 (GRCm39) L80Q probably damaging Het
Slc7a10 G T 7: 34,897,377 (GRCm39) probably null Het
Srrm2 C T 17: 24,038,593 (GRCm39) probably benign Het
Stk38 T G 17: 29,201,130 (GRCm39) D182A probably damaging Het
Tas2r104 C T 6: 131,662,398 (GRCm39) G104S probably benign Het
Tmem121b T C 6: 120,469,055 (GRCm39) E554G probably damaging Het
Tor1aip2 A G 1: 155,940,888 (GRCm39) H398R probably benign Het
Tram2 C T 1: 21,083,673 (GRCm39) V83I probably benign Het
Ube3a C T 7: 58,935,811 (GRCm39) T565I probably damaging Het
Ubr4 T C 4: 139,108,164 (GRCm39) V56A possibly damaging Het
Vmn1r128 T C 7: 21,083,644 (GRCm39) V116A possibly damaging Het
Vmn1r170 C T 7: 23,306,087 (GRCm39) T163I probably benign Het
Vmn2r75 T A 7: 85,813,290 (GRCm39) D504V possibly damaging Het
Vps36 G A 8: 22,708,436 (GRCm39) M363I probably benign Het
Wdsub1 A G 2: 59,708,661 (GRCm39) S71P probably damaging Het
Zdhhc12 A G 2: 29,981,496 (GRCm39) F189L probably benign Het
Zfp521 T C 18: 13,977,387 (GRCm39) M1009V probably benign Het
Other mutations in Apoe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Apoe APN 7 19,430,525 (GRCm39) missense probably damaging 1.00
IGL03324:Apoe APN 7 19,430,462 (GRCm39) missense probably benign 0.05
R0008:Apoe UTSW 7 19,431,005 (GRCm39) missense probably damaging 0.99
R2860:Apoe UTSW 7 19,431,479 (GRCm39) missense probably damaging 1.00
R2861:Apoe UTSW 7 19,431,479 (GRCm39) missense probably damaging 1.00
R2862:Apoe UTSW 7 19,431,479 (GRCm39) missense probably damaging 1.00
R3919:Apoe UTSW 7 19,430,472 (GRCm39) missense probably benign 0.00
R4756:Apoe UTSW 7 19,430,846 (GRCm39) missense probably benign 0.20
R5027:Apoe UTSW 7 19,430,940 (GRCm39) missense probably damaging 1.00
R6188:Apoe UTSW 7 19,432,305 (GRCm39) intron probably benign
R6464:Apoe UTSW 7 19,431,461 (GRCm39) missense probably damaging 1.00
R7652:Apoe UTSW 7 19,430,535 (GRCm39) missense possibly damaging 0.95
R8277:Apoe UTSW 7 19,432,303 (GRCm39) intron probably benign
R8513:Apoe UTSW 7 19,430,565 (GRCm39) missense probably damaging 1.00
R8932:Apoe UTSW 7 19,430,597 (GRCm39) missense possibly damaging 0.72
R9123:Apoe UTSW 7 19,432,375 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGTGTCCTCCATCAGTGCC -3'
(R):5'- GTCCTGACCCAGCCTTAAAC -3'

Sequencing Primer
(F):5'- TCGAAGCCAGCTTGAGTTAC -3'
(R):5'- CTTACTCTACACAGGATGCCTAG -3'
Posted On 2015-09-24