Incidental Mutation 'R4583:Arhgef1'
ID 343824
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene Name Rho guanine nucleotide exchange factor 1
Synonyms Lbcl2, Lsc
MMRRC Submission 041804-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.389) question?
Stock # R4583 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 24602337-24626019 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24611996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 93 (D93E)
Ref Sequence ENSEMBL: ENSMUSP00000145981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206011] [ENSMUST00000206508] [ENSMUST00000206906] [ENSMUST00000206028] [ENSMUST00000151121]
AlphaFold Q61210
Predicted Effect probably benign
Transcript: ENSMUST00000047873
AA Change: D126E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940
AA Change: D126E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
AA Change: D126E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940
AA Change: D126E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117419
AA Change: D126E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940
AA Change: D126E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117796
AA Change: D126E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940
AA Change: D126E

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127761
Predicted Effect probably benign
Transcript: ENSMUST00000132751
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145783
Predicted Effect probably benign
Transcript: ENSMUST00000205295
AA Change: D126E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206011
AA Change: D93E

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000206508
AA Change: D126E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206906
AA Change: D88E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000206028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144714
Predicted Effect probably benign
Transcript: ENSMUST00000151121
SMART Domains Protein: ENSMUSP00000114388
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 101 5.3e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,274,017 (GRCm39) L86P unknown Het
Aimp1 C T 3: 132,382,808 (GRCm39) E23K probably damaging Het
Ap2b1 A T 11: 83,288,605 (GRCm39) N884I probably benign Het
Apoe G T 7: 19,431,423 (GRCm39) Q65K possibly damaging Het
Arhgef12 G T 9: 42,888,958 (GRCm39) T1085K probably damaging Het
Arid5a T C 1: 36,356,745 (GRCm39) probably null Het
Atp9a A T 2: 168,531,280 (GRCm39) probably null Het
Baz1a T C 12: 54,969,325 (GRCm39) I635V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Cckar T A 5: 53,857,124 (GRCm39) M429L probably benign Het
Ccl3 A T 11: 83,539,164 (GRCm39) L65Q probably benign Het
Ccr3 A G 9: 123,829,477 (GRCm39) T271A probably benign Het
Cd8b1 T A 6: 71,303,081 (GRCm39) I52N probably damaging Het
Cdh15 G A 8: 123,591,767 (GRCm39) E551K probably damaging Het
Cdh17 A G 4: 11,810,466 (GRCm39) K719R probably benign Het
Cfap43 T C 19: 47,825,655 (GRCm39) R38G probably null Het
Chd6 T C 2: 160,856,114 (GRCm39) E715G probably damaging Het
Cldn34b2 T A X: 153,908,625 (GRCm39) R68* probably null Het
Col19a1 T G 1: 24,600,410 (GRCm39) D44A unknown Het
Colgalt2 C T 1: 152,382,627 (GRCm39) S493F probably damaging Het
Cr1l T C 1: 194,812,139 (GRCm39) I99M probably damaging Het
Crybg1 T C 10: 43,873,616 (GRCm39) E1164G probably damaging Het
Cym G T 3: 107,118,718 (GRCm39) D367E probably damaging Het
Dennd2a G T 6: 39,499,776 (GRCm39) T263K probably damaging Het
Dhx9 T A 1: 153,336,049 (GRCm39) M869L probably damaging Het
Dnm2 A G 9: 21,415,742 (GRCm39) H692R probably damaging Het
Ern1 A T 11: 106,298,031 (GRCm39) S697T probably damaging Het
F12 G A 13: 55,568,943 (GRCm39) T273I probably benign Het
Fam151b A T 13: 92,604,617 (GRCm39) L124Q probably damaging Het
Fancg A G 4: 43,002,991 (GRCm39) V622A probably benign Het
Fbxo2 T A 4: 148,249,356 (GRCm39) N159K possibly damaging Het
Fgd2 C A 17: 29,586,052 (GRCm39) T212K possibly damaging Het
Fhl3 T A 4: 124,601,342 (GRCm39) D178E probably benign Het
Filip1 G T 9: 79,723,091 (GRCm39) A1176D possibly damaging Het
Fndc1 T C 17: 7,958,081 (GRCm39) Y1722C probably damaging Het
Frem3 T C 8: 81,340,143 (GRCm39) V812A probably benign Het
Fsip2 A G 2: 82,809,017 (GRCm39) I1779V probably benign Het
Gli2 C T 1: 118,769,798 (GRCm39) V585I probably benign Het
Gm15056 C G 8: 21,390,697 (GRCm39) S80T probably benign Het
Gm5145 A G 17: 20,790,715 (GRCm39) E31G probably benign Het
Gmfg A G 7: 28,145,369 (GRCm39) Y71C probably damaging Het
Grk1 A G 8: 13,459,322 (GRCm39) E291G probably damaging Het
Gtpbp1 A G 15: 79,600,152 (GRCm39) E393G possibly damaging Het
Gtpbp2 A G 17: 46,472,071 (GRCm39) D2G probably damaging Het
Hc A T 2: 34,918,189 (GRCm39) V698E probably benign Het
Helz G A 11: 107,536,895 (GRCm39) R249H probably damaging Het
Hmcn2 A G 2: 31,303,277 (GRCm39) I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,493,950 (GRCm39) R286G probably benign Het
Hus1b A T 13: 31,131,501 (GRCm39) W53R probably damaging Het
Hydin C T 8: 111,321,857 (GRCm39) T4503I probably benign Het
Ighmbp2 G C 19: 3,315,324 (GRCm39) P699A probably benign Het
Igkv1-122 A T 6: 67,994,442 (GRCm39) Y110F probably benign Het
Igkv8-28 T C 6: 70,120,604 (GRCm39) Y113C probably damaging Het
Iigp1c T C 18: 60,379,152 (GRCm39) I229T possibly damaging Het
Il16 A G 7: 83,332,107 (GRCm39) S158P probably damaging Het
Kalrn T A 16: 34,055,637 (GRCm39) H876L probably damaging Het
Kdm5d T A Y: 914,134 (GRCm39) L357H probably damaging Het
Krt78 T C 15: 101,855,055 (GRCm39) T919A possibly damaging Het
L3mbtl2 T C 15: 81,569,107 (GRCm39) C594R probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lgals3 A T 14: 47,619,144 (GRCm39) probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lpcat3 T G 6: 124,680,286 (GRCm39) W429G possibly damaging Het
Lrp1 T C 10: 127,377,241 (GRCm39) T4149A probably benign Het
Memo1 G A 17: 74,565,456 (GRCm39) Q36* probably null Het
Mical2 A G 7: 112,012,154 (GRCm39) N668S probably benign Het
Ms4a10 A T 19: 10,945,553 (GRCm39) I76N possibly damaging Het
Mthfr T G 4: 148,136,329 (GRCm39) L362V possibly damaging Het
Myh3 T A 11: 66,987,279 (GRCm39) Y1376* probably null Het
Mymk C A 2: 26,952,292 (GRCm39) V192F probably benign Het
Myo1c A G 11: 75,562,688 (GRCm39) D966G possibly damaging Het
Ncam2 A G 16: 81,314,445 (GRCm39) N474D probably damaging Het
Nmnat1 T C 4: 149,553,608 (GRCm39) N168S possibly damaging Het
Nmur1 C T 1: 86,314,367 (GRCm39) V323M possibly damaging Het
Npr2 C A 4: 43,633,522 (GRCm39) probably null Het
Nsd3 T A 8: 26,200,703 (GRCm39) M1265K probably benign Het
Or13c7 A G 4: 43,855,262 (GRCm39) T318A probably benign Het
Or1e34 T C 11: 73,778,629 (GRCm39) T190A probably damaging Het
Or1j16 A C 2: 36,530,626 (GRCm39) T192P probably damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or4c11 G T 2: 88,695,838 (GRCm39) M296I probably benign Het
Or5b108 T A 19: 13,168,062 (GRCm39) F10L probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Or6c216 T C 10: 129,678,344 (GRCm39) D189G probably damaging Het
Otub1 G A 19: 7,181,801 (GRCm39) A25V possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl2 A G 2: 121,957,226 (GRCm39) S103P probably benign Het
Pcdhb15 A T 18: 37,608,628 (GRCm39) H620L possibly damaging Het
Pdgfc A T 3: 81,048,835 (GRCm39) D81V possibly damaging Het
Pdia2 T C 17: 26,415,476 (GRCm39) D447G probably damaging Het
Pold1 C A 7: 44,188,337 (GRCm39) A514S probably damaging Het
Pomgnt1 C T 4: 116,015,691 (GRCm39) T552I probably benign Het
Ppl T C 16: 4,922,400 (GRCm39) E294G probably benign Het
Pramel12 A G 4: 143,143,324 (GRCm39) Y30C probably damaging Het
Prkcb A G 7: 122,056,447 (GRCm39) S100G probably benign Het
Psg16 T G 7: 16,829,097 (GRCm39) I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 122,601,175 (GRCm39) probably benign Het
Reck T C 4: 43,931,062 (GRCm39) probably null Het
Rrbp1 C T 2: 143,830,671 (GRCm39) G499S probably benign Het
Sema6d G T 2: 124,506,082 (GRCm39) R630L probably damaging Het
Slc29a1 A G 17: 45,900,882 (GRCm39) V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 (GRCm39) Q324L probably benign Het
Slc35c1 A T 2: 92,289,266 (GRCm39) L80Q probably damaging Het
Slc7a10 G T 7: 34,897,377 (GRCm39) probably null Het
Srrm2 C T 17: 24,038,593 (GRCm39) probably benign Het
Stk38 T G 17: 29,201,130 (GRCm39) D182A probably damaging Het
Tas2r104 C T 6: 131,662,398 (GRCm39) G104S probably benign Het
Tmem121b T C 6: 120,469,055 (GRCm39) E554G probably damaging Het
Tor1aip2 A G 1: 155,940,888 (GRCm39) H398R probably benign Het
Tram2 C T 1: 21,083,673 (GRCm39) V83I probably benign Het
Ube3a C T 7: 58,935,811 (GRCm39) T565I probably damaging Het
Ubr4 T C 4: 139,108,164 (GRCm39) V56A possibly damaging Het
Vmn1r128 T C 7: 21,083,644 (GRCm39) V116A possibly damaging Het
Vmn1r170 C T 7: 23,306,087 (GRCm39) T163I probably benign Het
Vmn2r75 T A 7: 85,813,290 (GRCm39) D504V possibly damaging Het
Vps36 G A 8: 22,708,436 (GRCm39) M363I probably benign Het
Wdsub1 A G 2: 59,708,661 (GRCm39) S71P probably damaging Het
Zdhhc12 A G 2: 29,981,496 (GRCm39) F189L probably benign Het
Zfp521 T C 18: 13,977,387 (GRCm39) M1009V probably benign Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24,607,784 (GRCm39) missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24,612,118 (GRCm39) missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24,625,376 (GRCm39) unclassified probably benign
IGL01479:Arhgef1 APN 7 24,612,028 (GRCm39) missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24,621,307 (GRCm39) missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24,625,208 (GRCm39) critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24,622,796 (GRCm39) missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24,611,977 (GRCm39) splice site probably benign
IGL02202:Arhgef1 APN 7 24,612,854 (GRCm39) nonsense probably null
IGL02324:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24,623,240 (GRCm39) missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24,623,157 (GRCm39) missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24,622,276 (GRCm39) missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24,616,268 (GRCm39) missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24,612,030 (GRCm39) nonsense probably null
R0277:Arhgef1 UTSW 7 24,623,224 (GRCm39) unclassified probably benign
R0336:Arhgef1 UTSW 7 24,621,382 (GRCm39) missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24,618,785 (GRCm39) intron probably benign
R0668:Arhgef1 UTSW 7 24,607,345 (GRCm39) missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24,619,129 (GRCm39) missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24,624,423 (GRCm39) missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24,613,057 (GRCm39) missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24,607,176 (GRCm39) missense unknown
R3855:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24,618,697 (GRCm39) missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24,625,271 (GRCm39) missense probably damaging 0.96
R4750:Arhgef1 UTSW 7 24,618,001 (GRCm39) intron probably benign
R4914:Arhgef1 UTSW 7 24,623,264 (GRCm39) missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24,624,447 (GRCm39) missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24,618,777 (GRCm39) critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24,611,732 (GRCm39) splice site probably null
R5604:Arhgef1 UTSW 7 24,612,210 (GRCm39) missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24,618,782 (GRCm39) splice site probably null
R6151:Arhgef1 UTSW 7 24,617,367 (GRCm39) missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24,619,205 (GRCm39) splice site probably null
R6943:Arhgef1 UTSW 7 24,623,156 (GRCm39) missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24,616,348 (GRCm39) missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24,615,461 (GRCm39) missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24,612,003 (GRCm39) missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24,619,135 (GRCm39) missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24,616,306 (GRCm39) missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24,618,641 (GRCm39) missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24,619,163 (GRCm39) missense probably damaging 1.00
R8132:Arhgef1 UTSW 7 24,619,174 (GRCm39) nonsense probably null
R8132:Arhgef1 UTSW 7 24,607,087 (GRCm39) intron probably benign
R8168:Arhgef1 UTSW 7 24,624,831 (GRCm39) missense probably benign 0.06
R8964:Arhgef1 UTSW 7 24,622,462 (GRCm39) missense probably damaging 1.00
R9114:Arhgef1 UTSW 7 24,607,304 (GRCm39) missense probably damaging 1.00
R9553:Arhgef1 UTSW 7 24,619,115 (GRCm39) missense probably damaging 1.00
R9676:Arhgef1 UTSW 7 24,625,501 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTCATGGGATGGAAGCCATG -3'
(R):5'- ACTTACTGGGTCTCCTCCAG -3'

Sequencing Primer
(F):5'- GGATGGAAGCCATGATTCAGTCATTC -3'
(R):5'- TCCCGGGCCTCATAGTTG -3'
Posted On 2015-09-24