Mutagenetix > Incidental Mutation

Incidental Mutation 'R4583:Il16'

343829

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

041804-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

R4583 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83682899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 158 (S158P)

Ref Sequence

ENSEMBL: ENSMUSP00000118516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000153560]

AlphaFold

O54824

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001792
AA Change: S158P

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: S158P

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000153560
AA Change: S158P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118516
Gene: ENSMUSG00000001741
AA Change: S158P

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	T	C	7: 27,574,592	L86P	unknown	Het
Aimp1	C	T	3: 132,677,047	E23K	probably damaging	Het
Ap2b1	A	T	11: 83,397,779	N884I	probably benign	Het
Apoe	G	T	7: 19,697,498	Q65K	possibly damaging	Het
Arhgef1	T	A	7: 24,912,571	D93E	probably benign	Het
Arhgef12	G	T	9: 42,977,662	T1085K	probably damaging	Het
Arid5a	T	C	1: 36,317,664		probably null	Het
Atp9a	A	T	2: 168,689,360		probably null	Het
Baz1a	T	C	12: 54,922,540	I635V	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Cckar	T	A	5: 53,699,782	M429L	probably benign	Het
Ccl3	A	T	11: 83,648,338	L65Q	probably benign	Het
Ccr3	A	G	9: 124,029,440	T271A	probably benign	Het
Cd8b1	T	A	6: 71,326,097	I52N	probably damaging	Het
Cdh15	G	A	8: 122,865,028	E551K	probably damaging	Het
Cdh17	A	G	4: 11,810,466	K719R	probably benign	Het
Cfap43	T	C	19: 47,837,216	R38G	probably null	Het
Chd6	T	C	2: 161,014,194	E715G	probably damaging	Het
Cldn34b2	T	A	X: 155,125,629	R68*	probably null	Het
Col19a1	T	G	1: 24,561,329	D44A	unknown	Het
Colgalt2	C	T	1: 152,506,876	S493F	probably damaging	Het
Cr1l	T	C	1: 195,129,831	I99M	probably damaging	Het
Crybg1	T	C	10: 43,997,620	E1164G	probably damaging	Het
Cym	G	T	3: 107,211,402	D367E	probably damaging	Het
Dennd2a	G	T	6: 39,522,842	T263K	probably damaging	Het
Dhx9	T	A	1: 153,460,303	M869L	probably damaging	Het
Dnm2	A	G	9: 21,504,446	H692R	probably damaging	Het
Ern1	A	T	11: 106,407,205	S697T	probably damaging	Het
F12	G	A	13: 55,421,130	T273I	probably benign	Het
Fam151b	A	T	13: 92,468,109	L124Q	probably damaging	Het
Fancg	A	G	4: 43,002,991	V622A	probably benign	Het
Fbxo2	T	A	4: 148,164,899	N159K	possibly damaging	Het
Fgd2	C	A	17: 29,367,078	T212K	possibly damaging	Het
Fhl3	T	A	4: 124,707,549	D178E	probably benign	Het
Filip1	G	T	9: 79,815,809	A1176D	possibly damaging	Het
Fndc1	T	C	17: 7,739,249	Y1722C	probably damaging	Het
Frem3	T	C	8: 80,613,514	V812A	probably benign	Het
Fsip2	A	G	2: 82,978,673	I1779V	probably benign	Het
Gli2	C	T	1: 118,842,068	V585I	probably benign	Het
Gm15056	C	G	8: 20,900,681	S80T	probably benign	Het
Gm4951	T	C	18: 60,246,080	I229T	possibly damaging	Het
Gm5145	A	G	17: 20,570,453	E31G	probably benign	Het
Gmfg	A	G	7: 28,445,944	Y71C	probably damaging	Het
Grk1	A	G	8: 13,409,322	E291G	probably damaging	Het
Gtpbp1	A	G	15: 79,715,951	E393G	possibly damaging	Het
Gtpbp2	A	G	17: 46,161,145	D2G	probably damaging	Het
Hc	A	T	2: 35,028,177	V698E	probably benign	Het
Helz	G	A	11: 107,646,069	R249H	probably damaging	Het
Hmcn2	A	G	2: 31,413,265	I2973V	possibly damaging	Het
Hnrnpa3	A	G	2: 75,663,606	R286G	probably benign	Het
Hus1b	A	T	13: 30,947,518	W53R	probably damaging	Het
Hydin	C	T	8: 110,595,225	T4503I	probably benign	Het
Ighmbp2	G	C	19: 3,265,324	P699A	probably benign	Het
Igkv1-122	A	T	6: 68,017,458	Y110F	probably benign	Het
Igkv8-28	T	C	6: 70,143,620	Y113C	probably damaging	Het
Kalrn	T	A	16: 34,235,267	H876L	probably damaging	Het
Kdm5d	T	A	Y: 914,134	L357H	probably damaging	Het
Krt78	T	C	15: 101,946,620	T919A	possibly damaging	Het
L3mbtl2	T	C	15: 81,684,906	C594R	probably damaging	Het
Lcorl	A	T	5: 45,733,589	L474*	probably null	Het
Lgals3	A	T	14: 47,381,687		probably null	Het
Lnx1	C	T	5: 74,610,796	V350I	probably benign	Het
Lpcat3	T	G	6: 124,703,323	W429G	possibly damaging	Het
Lrp1	T	C	10: 127,541,372	T4149A	probably benign	Het
Memo1	G	A	17: 74,258,461	Q36*	probably null	Het
Micalcl	A	G	7: 112,412,947	N668S	probably benign	Het
Ms4a10	A	T	19: 10,968,189	I76N	possibly damaging	Het
Mthfr	T	G	4: 148,051,872	L362V	possibly damaging	Het
Myh3	T	A	11: 67,096,453	Y1376*	probably null	Het
Mymk	C	A	2: 27,062,280	V192F	probably benign	Het
Myo1c	A	G	11: 75,671,862	D966G	possibly damaging	Het
Ncam2	A	G	16: 81,517,557	N474D	probably damaging	Het
Nmnat1	T	C	4: 149,469,151	N168S	possibly damaging	Het
Nmur1	C	T	1: 86,386,645	V323M	possibly damaging	Het
Npr2	C	A	4: 43,633,522		probably null	Het
Nsd3	T	A	8: 25,710,676	M1265K	probably benign	Het
Olfr1206	G	T	2: 88,865,494	M296I	probably benign	Het
Olfr1212	T	A	2: 88,959,212	F249I	probably damaging	Het
Olfr1462	T	A	19: 13,190,698	F10L	probably damaging	Het
Olfr152	T	C	2: 87,783,221	V227A	possibly damaging	Het
Olfr155	A	G	4: 43,855,262	T318A	probably benign	Het
Olfr345	A	C	2: 36,640,614	T192P	probably damaging	Het
Olfr394	T	C	11: 73,887,803	T190A	probably damaging	Het
Olfr812	T	C	10: 129,842,475	D189G	probably damaging	Het
Otub1	G	A	19: 7,204,436	A25V	possibly damaging	Het
Paqr3	T	A	5: 97,108,210	R102*	probably null	Het
Patl2	A	G	2: 122,126,745	S103P	probably benign	Het
Pcdhb15	A	T	18: 37,475,575	H620L	possibly damaging	Het
Pdgfc	A	T	3: 81,141,528	D81V	possibly damaging	Het
Pdia2	T	C	17: 26,196,502	D447G	probably damaging	Het
Pold1	C	A	7: 44,538,913	A514S	probably damaging	Het
Pomgnt1	C	T	4: 116,158,494	T552I	probably benign	Het
Ppl	T	C	16: 5,104,536	E294G	probably benign	Het
Pramef8	A	G	4: 143,416,754	Y30C	probably damaging	Het
Prkcb	A	G	7: 122,457,224	S100G	probably benign	Het
Psg16	T	G	7: 17,095,172	I227S	probably benign	Het
Rbbp6	AAAGAAGAAGAAGAAGAAG	AAAGAAGAAGAAGAAG	7: 123,001,952		probably benign	Het
Reck	T	C	4: 43,931,062		probably null	Het
Rrbp1	C	T	2: 143,988,751	G499S	probably benign	Het
Sema6d	G	T	2: 124,664,162	R630L	probably damaging	Het
Slc29a1	A	G	17: 45,589,956	V94A	possibly damaging	Het
Slc35a1	T	A	4: 34,664,146	Q324L	probably benign	Het
Slc35c1	A	T	2: 92,458,921	L80Q	probably damaging	Het
Slc7a10	G	T	7: 35,197,952		probably null	Het
Srrm2	C	T	17: 23,819,619		probably benign	Het
Stk38	T	G	17: 28,982,156	D182A	probably damaging	Het
Tas2r104	C	T	6: 131,685,435	G104S	probably benign	Het
Tmem121b	T	C	6: 120,492,094	E554G	probably damaging	Het
Tor1aip2	A	G	1: 156,065,142	H398R	probably benign	Het
Tram2	C	T	1: 21,013,449	V83I	probably benign	Het
Ube3a	C	T	7: 59,286,063	T565I	probably damaging	Het
Ubr4	T	C	4: 139,380,853	V56A	possibly damaging	Het
Vmn1r128	T	C	7: 21,349,719	V116A	possibly damaging	Het
Vmn1r170	C	T	7: 23,606,662	T163I	probably benign	Het
Vmn2r75	T	A	7: 86,164,082	D504V	possibly damaging	Het
Vps36	G	A	8: 22,218,420	M363I	probably benign	Het
Wdsub1	A	G	2: 59,878,317	S71P	probably damaging	Het
Zdhhc12	A	G	2: 30,091,484	F189L	probably benign	Het
Zfp521	T	C	18: 13,844,330	M1009V	probably benign	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8317:Il16	UTSW	7	83655330	missense	probably benign
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83652351	missense	probably benign
R9267:Il16	UTSW	7	83722549	missense	probably benign	0.01
R9445:Il16	UTSW	7	83688172	nonsense	probably null
R9595:Il16	UTSW	7	83673065	nonsense	probably null
R9651:Il16	UTSW	7	83682856	missense	probably damaging	0.96
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCTGACCAAACAAGCTCTCTG -3'
(R):5'- GCTGAATGGTTTCTGCCCAC -3'

Sequencing Primer
(F):5'- AACAAGCTCTCTGCAGTCTGTGAG -3'
(R):5'- GAATGGTTTCTGCCCACACAGAG -3'

Posted On

2015-09-24