Incidental Mutation 'R4583:Mical2'
ID 343831
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 4921517J23Rik, Ebitein1, 5330438E18Rik, Micalcl
MMRRC Submission 041804-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R4583 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 111825063-112012313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112012154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 668 (N668S)
Ref Sequence ENSEMBL: ENSMUSP00000102256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051308] [ENSMUST00000106645]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect probably benign
Transcript: ENSMUST00000051308
AA Change: N668S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000062443
Gene: ENSMUSG00000030771
AA Change: N668S

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106645
AA Change: N668S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102256
Gene: ENSMUSG00000030771
AA Change: N668S

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140202
Predicted Effect not run
Transcript: ENSMUST00000153697
AA Change: N559S
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,274,017 (GRCm39) L86P unknown Het
Aimp1 C T 3: 132,382,808 (GRCm39) E23K probably damaging Het
Ap2b1 A T 11: 83,288,605 (GRCm39) N884I probably benign Het
Apoe G T 7: 19,431,423 (GRCm39) Q65K possibly damaging Het
Arhgef1 T A 7: 24,611,996 (GRCm39) D93E probably benign Het
Arhgef12 G T 9: 42,888,958 (GRCm39) T1085K probably damaging Het
Arid5a T C 1: 36,356,745 (GRCm39) probably null Het
Atp9a A T 2: 168,531,280 (GRCm39) probably null Het
Baz1a T C 12: 54,969,325 (GRCm39) I635V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Cckar T A 5: 53,857,124 (GRCm39) M429L probably benign Het
Ccl3 A T 11: 83,539,164 (GRCm39) L65Q probably benign Het
Ccr3 A G 9: 123,829,477 (GRCm39) T271A probably benign Het
Cd8b1 T A 6: 71,303,081 (GRCm39) I52N probably damaging Het
Cdh15 G A 8: 123,591,767 (GRCm39) E551K probably damaging Het
Cdh17 A G 4: 11,810,466 (GRCm39) K719R probably benign Het
Cfap43 T C 19: 47,825,655 (GRCm39) R38G probably null Het
Chd6 T C 2: 160,856,114 (GRCm39) E715G probably damaging Het
Cldn34b2 T A X: 153,908,625 (GRCm39) R68* probably null Het
Col19a1 T G 1: 24,600,410 (GRCm39) D44A unknown Het
Colgalt2 C T 1: 152,382,627 (GRCm39) S493F probably damaging Het
Cr1l T C 1: 194,812,139 (GRCm39) I99M probably damaging Het
Crybg1 T C 10: 43,873,616 (GRCm39) E1164G probably damaging Het
Cym G T 3: 107,118,718 (GRCm39) D367E probably damaging Het
Dennd2a G T 6: 39,499,776 (GRCm39) T263K probably damaging Het
Dhx9 T A 1: 153,336,049 (GRCm39) M869L probably damaging Het
Dnm2 A G 9: 21,415,742 (GRCm39) H692R probably damaging Het
Ern1 A T 11: 106,298,031 (GRCm39) S697T probably damaging Het
F12 G A 13: 55,568,943 (GRCm39) T273I probably benign Het
Fam151b A T 13: 92,604,617 (GRCm39) L124Q probably damaging Het
Fancg A G 4: 43,002,991 (GRCm39) V622A probably benign Het
Fbxo2 T A 4: 148,249,356 (GRCm39) N159K possibly damaging Het
Fgd2 C A 17: 29,586,052 (GRCm39) T212K possibly damaging Het
Fhl3 T A 4: 124,601,342 (GRCm39) D178E probably benign Het
Filip1 G T 9: 79,723,091 (GRCm39) A1176D possibly damaging Het
Fndc1 T C 17: 7,958,081 (GRCm39) Y1722C probably damaging Het
Frem3 T C 8: 81,340,143 (GRCm39) V812A probably benign Het
Fsip2 A G 2: 82,809,017 (GRCm39) I1779V probably benign Het
Gli2 C T 1: 118,769,798 (GRCm39) V585I probably benign Het
Gm15056 C G 8: 21,390,697 (GRCm39) S80T probably benign Het
Gm5145 A G 17: 20,790,715 (GRCm39) E31G probably benign Het
Gmfg A G 7: 28,145,369 (GRCm39) Y71C probably damaging Het
Grk1 A G 8: 13,459,322 (GRCm39) E291G probably damaging Het
Gtpbp1 A G 15: 79,600,152 (GRCm39) E393G possibly damaging Het
Gtpbp2 A G 17: 46,472,071 (GRCm39) D2G probably damaging Het
Hc A T 2: 34,918,189 (GRCm39) V698E probably benign Het
Helz G A 11: 107,536,895 (GRCm39) R249H probably damaging Het
Hmcn2 A G 2: 31,303,277 (GRCm39) I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,493,950 (GRCm39) R286G probably benign Het
Hus1b A T 13: 31,131,501 (GRCm39) W53R probably damaging Het
Hydin C T 8: 111,321,857 (GRCm39) T4503I probably benign Het
Ighmbp2 G C 19: 3,315,324 (GRCm39) P699A probably benign Het
Igkv1-122 A T 6: 67,994,442 (GRCm39) Y110F probably benign Het
Igkv8-28 T C 6: 70,120,604 (GRCm39) Y113C probably damaging Het
Iigp1c T C 18: 60,379,152 (GRCm39) I229T possibly damaging Het
Il16 A G 7: 83,332,107 (GRCm39) S158P probably damaging Het
Kalrn T A 16: 34,055,637 (GRCm39) H876L probably damaging Het
Kdm5d T A Y: 914,134 (GRCm39) L357H probably damaging Het
Krt78 T C 15: 101,855,055 (GRCm39) T919A possibly damaging Het
L3mbtl2 T C 15: 81,569,107 (GRCm39) C594R probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lgals3 A T 14: 47,619,144 (GRCm39) probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lpcat3 T G 6: 124,680,286 (GRCm39) W429G possibly damaging Het
Lrp1 T C 10: 127,377,241 (GRCm39) T4149A probably benign Het
Memo1 G A 17: 74,565,456 (GRCm39) Q36* probably null Het
Ms4a10 A T 19: 10,945,553 (GRCm39) I76N possibly damaging Het
Mthfr T G 4: 148,136,329 (GRCm39) L362V possibly damaging Het
Myh3 T A 11: 66,987,279 (GRCm39) Y1376* probably null Het
Mymk C A 2: 26,952,292 (GRCm39) V192F probably benign Het
Myo1c A G 11: 75,562,688 (GRCm39) D966G possibly damaging Het
Ncam2 A G 16: 81,314,445 (GRCm39) N474D probably damaging Het
Nmnat1 T C 4: 149,553,608 (GRCm39) N168S possibly damaging Het
Nmur1 C T 1: 86,314,367 (GRCm39) V323M possibly damaging Het
Npr2 C A 4: 43,633,522 (GRCm39) probably null Het
Nsd3 T A 8: 26,200,703 (GRCm39) M1265K probably benign Het
Or13c7 A G 4: 43,855,262 (GRCm39) T318A probably benign Het
Or1e34 T C 11: 73,778,629 (GRCm39) T190A probably damaging Het
Or1j16 A C 2: 36,530,626 (GRCm39) T192P probably damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or4c11 G T 2: 88,695,838 (GRCm39) M296I probably benign Het
Or5b108 T A 19: 13,168,062 (GRCm39) F10L probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Or6c216 T C 10: 129,678,344 (GRCm39) D189G probably damaging Het
Otub1 G A 19: 7,181,801 (GRCm39) A25V possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl2 A G 2: 121,957,226 (GRCm39) S103P probably benign Het
Pcdhb15 A T 18: 37,608,628 (GRCm39) H620L possibly damaging Het
Pdgfc A T 3: 81,048,835 (GRCm39) D81V possibly damaging Het
Pdia2 T C 17: 26,415,476 (GRCm39) D447G probably damaging Het
Pold1 C A 7: 44,188,337 (GRCm39) A514S probably damaging Het
Pomgnt1 C T 4: 116,015,691 (GRCm39) T552I probably benign Het
Ppl T C 16: 4,922,400 (GRCm39) E294G probably benign Het
Pramel12 A G 4: 143,143,324 (GRCm39) Y30C probably damaging Het
Prkcb A G 7: 122,056,447 (GRCm39) S100G probably benign Het
Psg16 T G 7: 16,829,097 (GRCm39) I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 122,601,175 (GRCm39) probably benign Het
Reck T C 4: 43,931,062 (GRCm39) probably null Het
Rrbp1 C T 2: 143,830,671 (GRCm39) G499S probably benign Het
Sema6d G T 2: 124,506,082 (GRCm39) R630L probably damaging Het
Slc29a1 A G 17: 45,900,882 (GRCm39) V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 (GRCm39) Q324L probably benign Het
Slc35c1 A T 2: 92,289,266 (GRCm39) L80Q probably damaging Het
Slc7a10 G T 7: 34,897,377 (GRCm39) probably null Het
Srrm2 C T 17: 24,038,593 (GRCm39) probably benign Het
Stk38 T G 17: 29,201,130 (GRCm39) D182A probably damaging Het
Tas2r104 C T 6: 131,662,398 (GRCm39) G104S probably benign Het
Tmem121b T C 6: 120,469,055 (GRCm39) E554G probably damaging Het
Tor1aip2 A G 1: 155,940,888 (GRCm39) H398R probably benign Het
Tram2 C T 1: 21,083,673 (GRCm39) V83I probably benign Het
Ube3a C T 7: 58,935,811 (GRCm39) T565I probably damaging Het
Ubr4 T C 4: 139,108,164 (GRCm39) V56A possibly damaging Het
Vmn1r128 T C 7: 21,083,644 (GRCm39) V116A possibly damaging Het
Vmn1r170 C T 7: 23,306,087 (GRCm39) T163I probably benign Het
Vmn2r75 T A 7: 85,813,290 (GRCm39) D504V possibly damaging Het
Vps36 G A 8: 22,708,436 (GRCm39) M363I probably benign Het
Wdsub1 A G 2: 59,708,661 (GRCm39) S71P probably damaging Het
Zdhhc12 A G 2: 29,981,496 (GRCm39) F189L probably benign Het
Zfp521 T C 18: 13,977,387 (GRCm39) M1009V probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Mical2 APN 7 111,981,352 (GRCm39) missense possibly damaging 0.94
IGL00886:Mical2 APN 7 111,914,279 (GRCm39) missense probably benign 0.00
IGL00934:Mical2 APN 7 111,948,610 (GRCm39) missense probably damaging 1.00
IGL00941:Mical2 APN 7 111,920,652 (GRCm39) splice site probably benign
IGL01020:Mical2 APN 7 111,914,283 (GRCm39) splice site probably benign
IGL01395:Mical2 APN 7 111,922,792 (GRCm39) missense probably damaging 1.00
IGL01658:Mical2 APN 7 111,914,205 (GRCm39) missense probably damaging 1.00
IGL01775:Mical2 APN 7 111,981,269 (GRCm39) missense possibly damaging 0.89
IGL02040:Mical2 APN 7 111,910,613 (GRCm39) missense probably damaging 1.00
IGL02051:Mical2 APN 7 111,980,597 (GRCm39) missense probably benign 0.30
IGL02388:Mical2 APN 7 111,934,620 (GRCm39) missense probably benign
IGL02551:Mical2 APN 7 111,923,197 (GRCm39) missense probably benign 0.01
IGL02578:Mical2 APN 7 111,950,580 (GRCm39) missense probably benign 0.05
IGL02751:Mical2 APN 7 111,931,243 (GRCm39) missense probably benign 0.11
IGL03114:Mical2 APN 7 111,996,764 (GRCm39) missense probably damaging 1.00
R0091:Mical2 UTSW 7 111,980,503 (GRCm39) missense probably benign 0.05
R0101:Mical2 UTSW 7 111,936,074 (GRCm39) missense possibly damaging 0.86
R0415:Mical2 UTSW 7 111,980,235 (GRCm39) missense probably damaging 1.00
R0504:Mical2 UTSW 7 111,870,524 (GRCm39) missense probably benign 0.00
R0594:Mical2 UTSW 7 111,917,657 (GRCm39) missense probably damaging 0.97
R0609:Mical2 UTSW 7 111,920,647 (GRCm39) splice site probably null
R0962:Mical2 UTSW 7 111,979,624 (GRCm39) missense probably damaging 0.99
R1521:Mical2 UTSW 7 111,980,817 (GRCm39) missense probably damaging 1.00
R1542:Mical2 UTSW 7 111,908,675 (GRCm39) missense probably damaging 1.00
R1611:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R1740:Mical2 UTSW 7 111,933,043 (GRCm39) missense probably benign
R1815:Mical2 UTSW 7 112,012,109 (GRCm39) missense probably damaging 1.00
R1855:Mical2 UTSW 7 111,944,489 (GRCm39) missense probably benign 0.21
R1958:Mical2 UTSW 7 111,980,311 (GRCm39) missense probably benign 0.00
R1962:Mical2 UTSW 7 112,012,051 (GRCm39) missense probably benign 0.14
R2086:Mical2 UTSW 7 111,917,810 (GRCm39) missense probably benign 0.31
R2136:Mical2 UTSW 7 111,870,722 (GRCm39) missense possibly damaging 0.72
R2418:Mical2 UTSW 7 111,919,941 (GRCm39) critical splice donor site probably null
R2439:Mical2 UTSW 7 111,994,002 (GRCm39) missense probably damaging 0.99
R3053:Mical2 UTSW 7 111,910,630 (GRCm39) missense probably damaging 1.00
R3979:Mical2 UTSW 7 112,006,885 (GRCm39) splice site probably null
R4308:Mical2 UTSW 7 111,931,199 (GRCm39) missense probably benign 0.27
R4551:Mical2 UTSW 7 111,981,123 (GRCm39) missense possibly damaging 0.87
R4663:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R4868:Mical2 UTSW 7 111,917,831 (GRCm39) missense probably damaging 1.00
R4902:Mical2 UTSW 7 111,936,107 (GRCm39) missense probably benign
R5112:Mical2 UTSW 7 111,919,818 (GRCm39) missense probably damaging 1.00
R5459:Mical2 UTSW 7 111,981,444 (GRCm39) missense probably benign 0.00
R5487:Mical2 UTSW 7 111,919,842 (GRCm39) missense probably damaging 1.00
R5563:Mical2 UTSW 7 111,914,185 (GRCm39) missense probably damaging 1.00
R5763:Mical2 UTSW 7 111,973,861 (GRCm39) critical splice donor site probably null
R5817:Mical2 UTSW 7 111,922,866 (GRCm39) missense probably benign
R5987:Mical2 UTSW 7 111,934,155 (GRCm39) missense probably benign 0.00
R6042:Mical2 UTSW 7 111,979,619 (GRCm39) missense probably benign 0.40
R6087:Mical2 UTSW 7 111,917,692 (GRCm39) nonsense probably null
R6189:Mical2 UTSW 7 112,012,087 (GRCm39) missense probably damaging 1.00
R6209:Mical2 UTSW 7 111,923,293 (GRCm39) splice site probably null
R6311:Mical2 UTSW 7 111,922,765 (GRCm39) missense probably damaging 1.00
R6319:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R6578:Mical2 UTSW 7 111,910,652 (GRCm39) missense probably damaging 1.00
R6750:Mical2 UTSW 7 111,981,046 (GRCm39) missense probably damaging 0.98
R6782:Mical2 UTSW 7 111,945,968 (GRCm39) missense probably damaging 1.00
R6798:Mical2 UTSW 7 111,975,266 (GRCm39) utr 3 prime probably benign
R7061:Mical2 UTSW 7 111,946,008 (GRCm39) missense probably benign 0.10
R7147:Mical2 UTSW 7 111,922,810 (GRCm39) missense possibly damaging 0.77
R7260:Mical2 UTSW 7 111,919,001 (GRCm39) missense probably benign 0.10
R7266:Mical2 UTSW 7 111,902,963 (GRCm39) missense probably damaging 1.00
R7347:Mical2 UTSW 7 111,981,358 (GRCm39) missense probably benign 0.01
R7391:Mical2 UTSW 7 111,919,816 (GRCm39) missense probably damaging 1.00
R7724:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
R7747:Mical2 UTSW 7 111,933,046 (GRCm39) missense probably benign 0.02
R7783:Mical2 UTSW 7 112,012,183 (GRCm39) missense probably damaging 1.00
R7818:Mical2 UTSW 7 111,944,514 (GRCm39) missense probably damaging 1.00
R7824:Mical2 UTSW 7 112,006,844 (GRCm39) missense probably damaging 1.00
R7995:Mical2 UTSW 7 111,980,975 (GRCm39) missense probably benign 0.31
R8022:Mical2 UTSW 7 111,902,974 (GRCm39) missense probably damaging 1.00
R8429:Mical2 UTSW 7 111,944,460 (GRCm39) missense probably benign 0.01
R8505:Mical2 UTSW 7 111,919,007 (GRCm39) missense probably benign 0.02
R8532:Mical2 UTSW 7 111,917,751 (GRCm39) missense probably damaging 1.00
R8830:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R8862:Mical2 UTSW 7 111,910,574 (GRCm39) missense probably damaging 1.00
R8906:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R8988:Mical2 UTSW 7 111,910,661 (GRCm39) missense possibly damaging 0.63
R9006:Mical2 UTSW 7 111,981,323 (GRCm39) missense probably benign 0.13
R9123:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9127:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9128:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9129:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9140:Mical2 UTSW 7 112,006,826 (GRCm39) missense probably damaging 1.00
R9187:Mical2 UTSW 7 111,902,797 (GRCm39) nonsense probably null
R9233:Mical2 UTSW 7 111,981,399 (GRCm39) missense probably benign 0.05
R9304:Mical2 UTSW 7 111,980,974 (GRCm39) missense probably damaging 0.97
R9310:Mical2 UTSW 7 111,950,920 (GRCm39) missense probably benign 0.45
R9377:Mical2 UTSW 7 111,981,246 (GRCm39) missense probably benign 0.10
R9399:Mical2 UTSW 7 111,946,082 (GRCm39) missense probably damaging 1.00
R9457:Mical2 UTSW 7 112,010,665 (GRCm39) missense probably damaging 0.96
R9500:Mical2 UTSW 7 111,936,054 (GRCm39) critical splice acceptor site probably null
R9620:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R9652:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
R9657:Mical2 UTSW 7 111,921,806 (GRCm39) missense probably benign 0.37
R9756:Mical2 UTSW 7 111,902,928 (GRCm39) missense probably damaging 0.99
R9789:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
RF008:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
X0062:Mical2 UTSW 7 111,946,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCTTTCCCGAGCATTG -3'
(R):5'- GTTCAAGGGCCTTTCTCACTG -3'

Sequencing Primer
(F):5'- GGAGATGATGCAGGTGATT -3'
(R):5'- AGCCTTTCTCAGCAGGGATTACAG -3'
Posted On 2015-09-24