Incidental Mutation 'R4583:Hydin'
ID343839
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene NameHYDIN, axonemal central pair apparatus protein
Synonymshy-3, hyrh, hy3, 1700034M11Rik, 4930545D19Rik
MMRRC Submission 041804-MU
Accession Numbers

Ncbi RefSeq: NM_172916; MGI: 2389007

Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R4583 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110266977-110610253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110595225 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 4503 (T4503I)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: T4503I

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: T4503I

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 1856913; 3801608
Lethality: D28-D42
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,574,592 L86P unknown Het
Aimp1 C T 3: 132,677,047 E23K probably damaging Het
Ap2b1 A T 11: 83,397,779 N884I probably benign Het
Apoe G T 7: 19,697,498 Q65K possibly damaging Het
Arhgef1 T A 7: 24,912,571 D93E probably benign Het
Arhgef12 G T 9: 42,977,662 T1085K probably damaging Het
Arid5a T C 1: 36,317,664 probably null Het
Atp9a A T 2: 168,689,360 probably null Het
Baz1a T C 12: 54,922,540 I635V probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Cckar T A 5: 53,699,782 M429L probably benign Het
Ccl3 A T 11: 83,648,338 L65Q probably benign Het
Ccr3 A G 9: 124,029,440 T271A probably benign Het
Cd8b1 T A 6: 71,326,097 I52N probably damaging Het
Cdh15 G A 8: 122,865,028 E551K probably damaging Het
Cdh17 A G 4: 11,810,466 K719R probably benign Het
Cfap43 T C 19: 47,837,216 R38G probably null Het
Chd6 T C 2: 161,014,194 E715G probably damaging Het
Cldn34b2 T A X: 155,125,629 R68* probably null Het
Col19a1 T G 1: 24,561,329 D44A unknown Het
Colgalt2 C T 1: 152,506,876 S493F probably damaging Het
Cr1l T C 1: 195,129,831 I99M probably damaging Het
Crybg1 T C 10: 43,997,620 E1164G probably damaging Het
Cym G T 3: 107,211,402 D367E probably damaging Het
Dennd2a G T 6: 39,522,842 T263K probably damaging Het
Dhx9 T A 1: 153,460,303 M869L probably damaging Het
Dnm2 A G 9: 21,504,446 H692R probably damaging Het
Ern1 A T 11: 106,407,205 S697T probably damaging Het
F12 G A 13: 55,421,130 T273I probably benign Het
Fam151b A T 13: 92,468,109 L124Q probably damaging Het
Fancg A G 4: 43,002,991 V622A probably benign Het
Fbxo2 T A 4: 148,164,899 N159K possibly damaging Het
Fgd2 C A 17: 29,367,078 T212K possibly damaging Het
Fhl3 T A 4: 124,707,549 D178E probably benign Het
Filip1 G T 9: 79,815,809 A1176D possibly damaging Het
Fndc1 T C 17: 7,739,249 Y1722C probably damaging Het
Frem3 T C 8: 80,613,514 V812A probably benign Het
Fsip2 A G 2: 82,978,673 I1779V probably benign Het
Gli2 C T 1: 118,842,068 V585I probably benign Het
Gm15056 C G 8: 20,900,681 S80T probably benign Het
Gm4951 T C 18: 60,246,080 I229T possibly damaging Het
Gm5145 A G 17: 20,570,453 E31G probably benign Het
Gmfg A G 7: 28,445,944 Y71C probably damaging Het
Grk1 A G 8: 13,409,322 E291G probably damaging Het
Gtpbp1 A G 15: 79,715,951 E393G possibly damaging Het
Gtpbp2 A G 17: 46,161,145 D2G probably damaging Het
Hc A T 2: 35,028,177 V698E probably benign Het
Helz G A 11: 107,646,069 R249H probably damaging Het
Hmcn2 A G 2: 31,413,265 I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,663,606 R286G probably benign Het
Hus1b A T 13: 30,947,518 W53R probably damaging Het
Ighmbp2 G C 19: 3,265,324 P699A probably benign Het
Igkv1-122 A T 6: 68,017,458 Y110F probably benign Het
Igkv8-28 T C 6: 70,143,620 Y113C probably damaging Het
Il16 A G 7: 83,682,899 S158P probably damaging Het
Kalrn T A 16: 34,235,267 H876L probably damaging Het
Kdm5d T A Y: 914,134 L357H probably damaging Het
Krt78 T C 15: 101,946,620 T919A possibly damaging Het
L3mbtl2 T C 15: 81,684,906 C594R probably damaging Het
Lcorl A T 5: 45,733,589 L474* probably null Het
Lgals3 A T 14: 47,381,687 probably null Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Lpcat3 T G 6: 124,703,323 W429G possibly damaging Het
Lrp1 T C 10: 127,541,372 T4149A probably benign Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Micalcl A G 7: 112,412,947 N668S probably benign Het
Ms4a10 A T 19: 10,968,189 I76N possibly damaging Het
Mthfr T G 4: 148,051,872 L362V possibly damaging Het
Myh3 T A 11: 67,096,453 Y1376* probably null Het
Mymk C A 2: 27,062,280 V192F probably benign Het
Myo1c A G 11: 75,671,862 D966G possibly damaging Het
Ncam2 A G 16: 81,517,557 N474D probably damaging Het
Nmnat1 T C 4: 149,469,151 N168S possibly damaging Het
Nmur1 C T 1: 86,386,645 V323M possibly damaging Het
Npr2 C A 4: 43,633,522 probably null Het
Nsd3 T A 8: 25,710,676 M1265K probably benign Het
Olfr1206 G T 2: 88,865,494 M296I probably benign Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1462 T A 19: 13,190,698 F10L probably damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Olfr155 A G 4: 43,855,262 T318A probably benign Het
Olfr345 A C 2: 36,640,614 T192P probably damaging Het
Olfr394 T C 11: 73,887,803 T190A probably damaging Het
Olfr812 T C 10: 129,842,475 D189G probably damaging Het
Otub1 G A 19: 7,204,436 A25V possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Patl2 A G 2: 122,126,745 S103P probably benign Het
Pcdhb15 A T 18: 37,475,575 H620L possibly damaging Het
Pdgfc A T 3: 81,141,528 D81V possibly damaging Het
Pdia2 T C 17: 26,196,502 D447G probably damaging Het
Pold1 C A 7: 44,538,913 A514S probably damaging Het
Pomgnt1 C T 4: 116,158,494 T552I probably benign Het
Ppl T C 16: 5,104,536 E294G probably benign Het
Pramef8 A G 4: 143,416,754 Y30C probably damaging Het
Prkcb A G 7: 122,457,224 S100G probably benign Het
Psg16 T G 7: 17,095,172 I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 123,001,952 probably benign Het
Reck T C 4: 43,931,062 probably null Het
Rrbp1 C T 2: 143,988,751 G499S probably benign Het
Sema6d G T 2: 124,664,162 R630L probably damaging Het
Slc29a1 A G 17: 45,589,956 V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 Q324L probably benign Het
Slc35c1 A T 2: 92,458,921 L80Q probably damaging Het
Slc7a10 G T 7: 35,197,952 probably null Het
Srrm2 C T 17: 23,819,619 probably benign Het
Stk38 T G 17: 28,982,156 D182A probably damaging Het
Tas2r104 C T 6: 131,685,435 G104S probably benign Het
Tmem121b T C 6: 120,492,094 E554G probably damaging Het
Tor1aip2 A G 1: 156,065,142 H398R probably benign Het
Tram2 C T 1: 21,013,449 V83I probably benign Het
Ube3a C T 7: 59,286,063 T565I probably damaging Het
Ubr4 T C 4: 139,380,853 V56A possibly damaging Het
Vmn1r128 T C 7: 21,349,719 V116A possibly damaging Het
Vmn1r170 C T 7: 23,606,662 T163I probably benign Het
Vmn2r75 T A 7: 86,164,082 D504V possibly damaging Het
Vps36 G A 8: 22,218,420 M363I probably benign Het
Wdsub1 A G 2: 59,878,317 S71P probably damaging Het
Zdhhc12 A G 2: 30,091,484 F189L probably benign Het
Zfp521 T C 18: 13,844,330 M1009V probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 110569802 missense possibly damaging 0.69
IGL00432:Hydin APN 8 110601252 missense probably damaging 0.98
IGL01025:Hydin APN 8 110326401 missense probably benign 0.38
IGL01140:Hydin APN 8 110398062 missense probably benign 0.14
IGL01317:Hydin APN 8 110326446 missense probably damaging 0.98
IGL01473:Hydin APN 8 110312160 missense probably benign 0.08
IGL01473:Hydin APN 8 110354953 missense probably damaging 1.00
IGL01610:Hydin APN 8 110557713 missense probably benign 0.00
IGL01685:Hydin APN 8 110355033 nonsense probably null
IGL01734:Hydin APN 8 110490789 nonsense probably null
IGL01743:Hydin APN 8 110592776 missense possibly damaging 0.94
IGL01829:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL01919:Hydin APN 8 110519174 missense possibly damaging 0.89
IGL01946:Hydin APN 8 110490718 missense possibly damaging 0.91
IGL01983:Hydin APN 8 110514895 missense probably benign 0.02
IGL02122:Hydin APN 8 110494415 missense possibly damaging 0.86
IGL02140:Hydin APN 8 110566938 missense probably benign
IGL02158:Hydin APN 8 110609966 missense possibly damaging 0.89
IGL02167:Hydin APN 8 110418423 missense possibly damaging 0.96
IGL02171:Hydin APN 8 110451958 nonsense probably null
IGL02185:Hydin APN 8 110506476 missense possibly damaging 0.86
IGL02517:Hydin APN 8 110566972 missense probably benign 0.01
IGL02639:Hydin APN 8 110538449 missense probably benign 0.01
IGL02644:Hydin APN 8 110538468 missense probably damaging 1.00
IGL02652:Hydin APN 8 110589522 missense possibly damaging 0.68
IGL02658:Hydin APN 8 110413276 missense possibly damaging 0.86
IGL02706:Hydin APN 8 110410566 missense probably damaging 0.99
IGL02892:Hydin APN 8 110598959 missense possibly damaging 0.89
IGL02947:Hydin APN 8 110418462 missense probably damaging 0.96
IGL03136:Hydin APN 8 110418524 missense probably benign 0.22
IGL03248:Hydin APN 8 110595289 missense probably damaging 0.97
IGL03251:Hydin APN 8 110490596 missense probably damaging 1.00
IGL03350:Hydin APN 8 110312224 missense possibly damaging 0.86
IGL03366:Hydin APN 8 110267363 missense unknown
IGL03404:Hydin APN 8 110569777 missense probably benign 0.06
Franz_joseph UTSW 8 110601318 missense probably damaging 1.00
maria UTSW 8 110509127 splice site probably benign
teresa UTSW 8 110609671 missense possibly damaging 0.79
P0005:Hydin UTSW 8 110494289 critical splice acceptor site probably null
R0099:Hydin UTSW 8 110589561 missense probably damaging 1.00
R0125:Hydin UTSW 8 110462531 missense probably benign 0.12
R0157:Hydin UTSW 8 110300010 missense possibly damaging 0.86
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0241:Hydin UTSW 8 110398023 missense probably benign 0.04
R0255:Hydin UTSW 8 110565018 missense probably benign 0.00
R0352:Hydin UTSW 8 110569901 critical splice donor site probably null
R0379:Hydin UTSW 8 110509127 splice site probably benign
R0468:Hydin UTSW 8 110413223 missense possibly damaging 0.96
R0477:Hydin UTSW 8 110418498 missense probably damaging 1.00
R0479:Hydin UTSW 8 110599088 missense probably damaging 1.00
R0539:Hydin UTSW 8 110523072 missense probably benign
R0550:Hydin UTSW 8 110587775 missense probably benign 0.01
R0571:Hydin UTSW 8 110514103 splice site probably null
R0606:Hydin UTSW 8 110549798 splice site probably benign
R0789:Hydin UTSW 8 110566971 missense possibly damaging 0.53
R0849:Hydin UTSW 8 110598984 missense probably damaging 1.00
R0946:Hydin UTSW 8 110531053 missense probably benign 0.25
R1201:Hydin UTSW 8 110569855 missense probably benign 0.01
R1375:Hydin UTSW 8 110506222 critical splice donor site probably null
R1385:Hydin UTSW 8 110523204 missense probably benign 0.40
R1411:Hydin UTSW 8 110575031 missense probably benign 0.04
R1437:Hydin UTSW 8 110581985 nonsense probably null
R1447:Hydin UTSW 8 110523166 missense probably damaging 1.00
R1448:Hydin UTSW 8 110446585 missense probably benign 0.27
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1466:Hydin UTSW 8 110532953 missense possibly damaging 0.47
R1523:Hydin UTSW 8 110533271 missense probably benign 0.05
R1544:Hydin UTSW 8 110574854 missense probably benign 0.30
R1581:Hydin UTSW 8 110410460 missense probably benign
R1584:Hydin UTSW 8 110580815 missense probably benign 0.27
R1598:Hydin UTSW 8 110410674 missense possibly damaging 0.96
R1633:Hydin UTSW 8 110506982 missense probably benign 0.10
R1777:Hydin UTSW 8 110589571 missense probably benign 0.14
R1817:Hydin UTSW 8 110532827 missense probably benign 0.00
R1828:Hydin UTSW 8 110510894 missense probably benign 0.03
R1837:Hydin UTSW 8 110569625 missense probably benign 0.20
R1848:Hydin UTSW 8 110569808 missense probably benign 0.19
R1869:Hydin UTSW 8 110500705 missense possibly damaging 0.94
R1909:Hydin UTSW 8 110587772 missense probably damaging 1.00
R1928:Hydin UTSW 8 110502947 missense possibly damaging 0.93
R1950:Hydin UTSW 8 110609987 missense possibly damaging 0.64
R2095:Hydin UTSW 8 110462657 missense probably damaging 0.96
R2172:Hydin UTSW 8 110582049 missense probably benign 0.42
R2217:Hydin UTSW 8 110418506 missense probably benign
R2248:Hydin UTSW 8 110578203 missense probably benign 0.09
R2272:Hydin UTSW 8 110309132 missense probably benign 0.01
R2294:Hydin UTSW 8 110299959 missense probably damaging 0.99
R2315:Hydin UTSW 8 110398044 missense probably benign 0.01
R2330:Hydin UTSW 8 110565009 missense probably benign 0.01
R2374:Hydin UTSW 8 110565148 missense probably damaging 1.00
R2446:Hydin UTSW 8 110587715 missense possibly damaging 0.82
R2484:Hydin UTSW 8 110513115 missense possibly damaging 0.76
R2698:Hydin UTSW 8 110609929 missense possibly damaging 0.70
R2843:Hydin UTSW 8 110519114 missense probably benign
R2844:Hydin UTSW 8 110519114 missense probably benign
R2846:Hydin UTSW 8 110519114 missense probably benign
R2882:Hydin UTSW 8 110566923 missense possibly damaging 0.92
R2937:Hydin UTSW 8 110404295 missense possibly damaging 0.88
R3031:Hydin UTSW 8 110603216 missense possibly damaging 0.83
R3038:Hydin UTSW 8 110582689 missense probably damaging 1.00
R3121:Hydin UTSW 8 110506506 missense probably benign
R3157:Hydin UTSW 8 110267373 missense unknown
R3547:Hydin UTSW 8 110582067 missense possibly damaging 0.85
R3696:Hydin UTSW 8 110603279 missense probably damaging 1.00
R3850:Hydin UTSW 8 110563929 missense probably damaging 0.99
R3896:Hydin UTSW 8 110509079 missense possibly damaging 0.93
R3983:Hydin UTSW 8 110392325 missense probably damaging 1.00
R4031:Hydin UTSW 8 110610047 missense probably benign 0.30
R4072:Hydin UTSW 8 110505256 missense possibly damaging 0.68
R4095:Hydin UTSW 8 110541547 missense probably damaging 0.98
R4176:Hydin UTSW 8 110593820 missense probably benign 0.00
R4213:Hydin UTSW 8 110456507 missense possibly damaging 0.91
R4412:Hydin UTSW 8 110415736 missense probably damaging 0.99
R4471:Hydin UTSW 8 110587132 missense probably damaging 1.00
R4474:Hydin UTSW 8 110563865 missense probably benign 0.11
R4495:Hydin UTSW 8 110595402 missense probably damaging 0.99
R4508:Hydin UTSW 8 110519254 missense possibly damaging 0.91
R4578:Hydin UTSW 8 110267339 missense unknown
R4600:Hydin UTSW 8 110566950 missense probably benign 0.04
R4681:Hydin UTSW 8 110506471 missense possibly damaging 0.85
R4685:Hydin UTSW 8 110462522 missense probably damaging 0.99
R4689:Hydin UTSW 8 110595414 missense probably benign 0.18
R4735:Hydin UTSW 8 110555632 critical splice donor site probably null
R4736:Hydin UTSW 8 110523208 missense probably benign 0.02
R4740:Hydin UTSW 8 110446439 missense probably benign 0.06
R4771:Hydin UTSW 8 110532883 missense probably benign
R4777:Hydin UTSW 8 110410464 missense probably damaging 0.98
R4859:Hydin UTSW 8 110506494 missense possibly damaging 0.93
R4911:Hydin UTSW 8 110595438 missense probably benign 0.01
R4964:Hydin UTSW 8 110490673 missense possibly damaging 0.86
R4965:Hydin UTSW 8 110398095 missense probably benign
R4989:Hydin UTSW 8 110563922 missense possibly damaging 0.84
R4995:Hydin UTSW 8 110569642 missense probably damaging 0.97
R5059:Hydin UTSW 8 110505769 missense probably damaging 0.96
R5071:Hydin UTSW 8 110538473 missense probably benign 0.03
R5073:Hydin UTSW 8 110538473 missense probably benign 0.03
R5092:Hydin UTSW 8 110582668 missense probably benign 0.16
R5156:Hydin UTSW 8 110609701 missense probably benign 0.00
R5166:Hydin UTSW 8 110523142 missense possibly damaging 0.89
R5189:Hydin UTSW 8 110413211 critical splice acceptor site probably null
R5243:Hydin UTSW 8 110505748 missense possibly damaging 0.92
R5244:Hydin UTSW 8 110532819 missense possibly damaging 0.77
R5256:Hydin UTSW 8 110587223 missense possibly damaging 0.92
R5266:Hydin UTSW 8 110334784 missense possibly damaging 0.87
R5283:Hydin UTSW 8 110451980 missense possibly damaging 0.96
R5343:Hydin UTSW 8 110485419 missense probably benign 0.40
R5359:Hydin UTSW 8 110538372 missense probably benign 0.00
R5390:Hydin UTSW 8 110595467 missense probably benign
R5394:Hydin UTSW 8 110539842 splice site probably null
R5441:Hydin UTSW 8 110565109 missense possibly damaging 0.72
R5461:Hydin UTSW 8 110519231 missense probably damaging 0.96
R5662:Hydin UTSW 8 110580709 missense probably benign 0.02
R5695:Hydin UTSW 8 110535283 missense probably benign 0.35
R5732:Hydin UTSW 8 110452058 missense probably benign 0.03
R5774:Hydin UTSW 8 110571915 nonsense probably null
R5780:Hydin UTSW 8 110586080 missense probably damaging 1.00
R5787:Hydin UTSW 8 110326353 missense probably damaging 0.99
R5802:Hydin UTSW 8 110452060 missense possibly damaging 0.86
R5841:Hydin UTSW 8 110533214 missense possibly damaging 0.76
R5856:Hydin UTSW 8 110541842 missense probably damaging 0.99
R5893:Hydin UTSW 8 110490676 missense probably benign 0.12
R5963:Hydin UTSW 8 110494294 missense possibly damaging 0.93
R6008:Hydin UTSW 8 110599085 missense probably benign 0.02
R6019:Hydin UTSW 8 110566620 missense probably benign
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6038:Hydin UTSW 8 110599031 missense probably benign 0.16
R6133:Hydin UTSW 8 110601276 missense probably benign 0.00
R6135:Hydin UTSW 8 110462660 missense possibly damaging 0.85
R6157:Hydin UTSW 8 110528016 missense probably benign
R6209:Hydin UTSW 8 110593802 missense probably benign 0.05
R6238:Hydin UTSW 8 110392111 intron probably null
R6293:Hydin UTSW 8 110597911 missense possibly damaging 0.83
R6340:Hydin UTSW 8 110354942 splice site probably null
R6349:Hydin UTSW 8 110418459 nonsense probably null
R6357:Hydin UTSW 8 110541657 missense possibly damaging 0.86
R6385:Hydin UTSW 8 110312224 missense possibly damaging 0.86
R6396:Hydin UTSW 8 110506889 missense probably damaging 0.96
R6466:Hydin UTSW 8 110506968 missense possibly damaging 0.85
R6648:Hydin UTSW 8 110525667 intron probably null
R6671:Hydin UTSW 8 110601318 missense probably damaging 1.00
R6695:Hydin UTSW 8 110326460 missense probably benign 0.05
R6800:Hydin UTSW 8 110597971 missense probably benign 0.09
R6841:Hydin UTSW 8 110538375 missense probably benign 0.09
R6867:Hydin UTSW 8 110539802 missense probably benign 0.08
R6889:Hydin UTSW 8 110532856 missense possibly damaging 0.79
R6895:Hydin UTSW 8 110312251 missense probably benign 0.00
R6940:Hydin UTSW 8 110490611 missense probably damaging 1.00
R6951:Hydin UTSW 8 110398125 missense probably benign
R6980:Hydin UTSW 8 110413284 missense possibly damaging 0.91
R6981:Hydin UTSW 8 110531072 missense possibly damaging 0.89
R7061:Hydin UTSW 8 110603288 missense possibly damaging 0.90
R7085:Hydin UTSW 8 110603330 missense probably benign 0.03
R7086:Hydin UTSW 8 110600245 missense possibly damaging 0.68
R7110:Hydin UTSW 8 110354951 critical splice acceptor site probably null
R7158:Hydin UTSW 8 110609671 missense possibly damaging 0.79
R7163:Hydin UTSW 8 110603336 missense probably benign 0.25
R7209:Hydin UTSW 8 110489792 nonsense probably null
R7244:Hydin UTSW 8 110549675 missense probably damaging 0.98
R7347:Hydin UTSW 8 110600362 missense probably benign 0.06
R7349:Hydin UTSW 8 110398171 splice site probably null
R7359:Hydin UTSW 8 110506101 missense probably damaging 0.98
R7365:Hydin UTSW 8 110557662 missense probably damaging 0.99
R7365:Hydin UTSW 8 110601273 missense probably damaging 1.00
R7436:Hydin UTSW 8 110583914 missense probably damaging 0.96
R7528:Hydin UTSW 8 110380572 nonsense probably null
R7544:Hydin UTSW 8 110589525 missense probably benign 0.35
R7625:Hydin UTSW 8 110541844 missense probably benign 0.01
R7713:Hydin UTSW 8 110593812 missense possibly damaging 0.69
R7763:Hydin UTSW 8 110505843 missense possibly damaging 0.92
R7771:Hydin UTSW 8 110565085 missense probably damaging 0.97
R7794:Hydin UTSW 8 110509083 missense probably damaging 1.00
X0063:Hydin UTSW 8 110551319 missense probably damaging 1.00
Z1088:Hydin UTSW 8 110299973 missense probably benign 0.12
Z1088:Hydin UTSW 8 110586048 missense probably benign 0.00
Z1088:Hydin UTSW 8 110592791 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCACTGAGTCAAGGGGATGG -3'
(R):5'- GCTTGAGTTTGATACACAACGGG -3'

Sequencing Primer
(F):5'- TCAAGGGGATGGTTTGAGCCAC -3'
(R):5'- TCTTGGTCCAGGGAAATCTCCAG -3'
Posted On2015-09-24