Incidental Mutation 'R4583:Arhgef12'
ID 343842
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene Name Rho guanine nucleotide exchange factor 12
Synonyms 2310014B11Rik, LARG
MMRRC Submission 041804-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R4583 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 42875138-43017069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 42888958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1085 (T1085K)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
AlphaFold Q8R4H2
Predicted Effect probably damaging
Transcript: ENSMUST00000072767
AA Change: T1084K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: T1084K

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165665
AA Change: T1085K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: T1085K

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,274,017 (GRCm39) L86P unknown Het
Aimp1 C T 3: 132,382,808 (GRCm39) E23K probably damaging Het
Ap2b1 A T 11: 83,288,605 (GRCm39) N884I probably benign Het
Apoe G T 7: 19,431,423 (GRCm39) Q65K possibly damaging Het
Arhgef1 T A 7: 24,611,996 (GRCm39) D93E probably benign Het
Arid5a T C 1: 36,356,745 (GRCm39) probably null Het
Atp9a A T 2: 168,531,280 (GRCm39) probably null Het
Baz1a T C 12: 54,969,325 (GRCm39) I635V probably damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Cckar T A 5: 53,857,124 (GRCm39) M429L probably benign Het
Ccl3 A T 11: 83,539,164 (GRCm39) L65Q probably benign Het
Ccr3 A G 9: 123,829,477 (GRCm39) T271A probably benign Het
Cd8b1 T A 6: 71,303,081 (GRCm39) I52N probably damaging Het
Cdh15 G A 8: 123,591,767 (GRCm39) E551K probably damaging Het
Cdh17 A G 4: 11,810,466 (GRCm39) K719R probably benign Het
Cfap43 T C 19: 47,825,655 (GRCm39) R38G probably null Het
Chd6 T C 2: 160,856,114 (GRCm39) E715G probably damaging Het
Cldn34b2 T A X: 153,908,625 (GRCm39) R68* probably null Het
Col19a1 T G 1: 24,600,410 (GRCm39) D44A unknown Het
Colgalt2 C T 1: 152,382,627 (GRCm39) S493F probably damaging Het
Cr1l T C 1: 194,812,139 (GRCm39) I99M probably damaging Het
Crybg1 T C 10: 43,873,616 (GRCm39) E1164G probably damaging Het
Cym G T 3: 107,118,718 (GRCm39) D367E probably damaging Het
Dennd2a G T 6: 39,499,776 (GRCm39) T263K probably damaging Het
Dhx9 T A 1: 153,336,049 (GRCm39) M869L probably damaging Het
Dnm2 A G 9: 21,415,742 (GRCm39) H692R probably damaging Het
Ern1 A T 11: 106,298,031 (GRCm39) S697T probably damaging Het
F12 G A 13: 55,568,943 (GRCm39) T273I probably benign Het
Fam151b A T 13: 92,604,617 (GRCm39) L124Q probably damaging Het
Fancg A G 4: 43,002,991 (GRCm39) V622A probably benign Het
Fbxo2 T A 4: 148,249,356 (GRCm39) N159K possibly damaging Het
Fgd2 C A 17: 29,586,052 (GRCm39) T212K possibly damaging Het
Fhl3 T A 4: 124,601,342 (GRCm39) D178E probably benign Het
Filip1 G T 9: 79,723,091 (GRCm39) A1176D possibly damaging Het
Fndc1 T C 17: 7,958,081 (GRCm39) Y1722C probably damaging Het
Frem3 T C 8: 81,340,143 (GRCm39) V812A probably benign Het
Fsip2 A G 2: 82,809,017 (GRCm39) I1779V probably benign Het
Gli2 C T 1: 118,769,798 (GRCm39) V585I probably benign Het
Gm15056 C G 8: 21,390,697 (GRCm39) S80T probably benign Het
Gm5145 A G 17: 20,790,715 (GRCm39) E31G probably benign Het
Gmfg A G 7: 28,145,369 (GRCm39) Y71C probably damaging Het
Grk1 A G 8: 13,459,322 (GRCm39) E291G probably damaging Het
Gtpbp1 A G 15: 79,600,152 (GRCm39) E393G possibly damaging Het
Gtpbp2 A G 17: 46,472,071 (GRCm39) D2G probably damaging Het
Hc A T 2: 34,918,189 (GRCm39) V698E probably benign Het
Helz G A 11: 107,536,895 (GRCm39) R249H probably damaging Het
Hmcn2 A G 2: 31,303,277 (GRCm39) I2973V possibly damaging Het
Hnrnpa3 A G 2: 75,493,950 (GRCm39) R286G probably benign Het
Hus1b A T 13: 31,131,501 (GRCm39) W53R probably damaging Het
Hydin C T 8: 111,321,857 (GRCm39) T4503I probably benign Het
Ighmbp2 G C 19: 3,315,324 (GRCm39) P699A probably benign Het
Igkv1-122 A T 6: 67,994,442 (GRCm39) Y110F probably benign Het
Igkv8-28 T C 6: 70,120,604 (GRCm39) Y113C probably damaging Het
Iigp1c T C 18: 60,379,152 (GRCm39) I229T possibly damaging Het
Il16 A G 7: 83,332,107 (GRCm39) S158P probably damaging Het
Kalrn T A 16: 34,055,637 (GRCm39) H876L probably damaging Het
Kdm5d T A Y: 914,134 (GRCm39) L357H probably damaging Het
Krt78 T C 15: 101,855,055 (GRCm39) T919A possibly damaging Het
L3mbtl2 T C 15: 81,569,107 (GRCm39) C594R probably damaging Het
Lcorl A T 5: 45,890,931 (GRCm39) L474* probably null Het
Lgals3 A T 14: 47,619,144 (GRCm39) probably null Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Lpcat3 T G 6: 124,680,286 (GRCm39) W429G possibly damaging Het
Lrp1 T C 10: 127,377,241 (GRCm39) T4149A probably benign Het
Memo1 G A 17: 74,565,456 (GRCm39) Q36* probably null Het
Mical2 A G 7: 112,012,154 (GRCm39) N668S probably benign Het
Ms4a10 A T 19: 10,945,553 (GRCm39) I76N possibly damaging Het
Mthfr T G 4: 148,136,329 (GRCm39) L362V possibly damaging Het
Myh3 T A 11: 66,987,279 (GRCm39) Y1376* probably null Het
Mymk C A 2: 26,952,292 (GRCm39) V192F probably benign Het
Myo1c A G 11: 75,562,688 (GRCm39) D966G possibly damaging Het
Ncam2 A G 16: 81,314,445 (GRCm39) N474D probably damaging Het
Nmnat1 T C 4: 149,553,608 (GRCm39) N168S possibly damaging Het
Nmur1 C T 1: 86,314,367 (GRCm39) V323M possibly damaging Het
Npr2 C A 4: 43,633,522 (GRCm39) probably null Het
Nsd3 T A 8: 26,200,703 (GRCm39) M1265K probably benign Het
Or13c7 A G 4: 43,855,262 (GRCm39) T318A probably benign Het
Or1e34 T C 11: 73,778,629 (GRCm39) T190A probably damaging Het
Or1j16 A C 2: 36,530,626 (GRCm39) T192P probably damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or4c11 G T 2: 88,695,838 (GRCm39) M296I probably benign Het
Or5b108 T A 19: 13,168,062 (GRCm39) F10L probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Or6c216 T C 10: 129,678,344 (GRCm39) D189G probably damaging Het
Otub1 G A 19: 7,181,801 (GRCm39) A25V possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Patl2 A G 2: 121,957,226 (GRCm39) S103P probably benign Het
Pcdhb15 A T 18: 37,608,628 (GRCm39) H620L possibly damaging Het
Pdgfc A T 3: 81,048,835 (GRCm39) D81V possibly damaging Het
Pdia2 T C 17: 26,415,476 (GRCm39) D447G probably damaging Het
Pold1 C A 7: 44,188,337 (GRCm39) A514S probably damaging Het
Pomgnt1 C T 4: 116,015,691 (GRCm39) T552I probably benign Het
Ppl T C 16: 4,922,400 (GRCm39) E294G probably benign Het
Pramel12 A G 4: 143,143,324 (GRCm39) Y30C probably damaging Het
Prkcb A G 7: 122,056,447 (GRCm39) S100G probably benign Het
Psg16 T G 7: 16,829,097 (GRCm39) I227S probably benign Het
Rbbp6 AAAGAAGAAGAAGAAGAAG AAAGAAGAAGAAGAAG 7: 122,601,175 (GRCm39) probably benign Het
Reck T C 4: 43,931,062 (GRCm39) probably null Het
Rrbp1 C T 2: 143,830,671 (GRCm39) G499S probably benign Het
Sema6d G T 2: 124,506,082 (GRCm39) R630L probably damaging Het
Slc29a1 A G 17: 45,900,882 (GRCm39) V94A possibly damaging Het
Slc35a1 T A 4: 34,664,146 (GRCm39) Q324L probably benign Het
Slc35c1 A T 2: 92,289,266 (GRCm39) L80Q probably damaging Het
Slc7a10 G T 7: 34,897,377 (GRCm39) probably null Het
Srrm2 C T 17: 24,038,593 (GRCm39) probably benign Het
Stk38 T G 17: 29,201,130 (GRCm39) D182A probably damaging Het
Tas2r104 C T 6: 131,662,398 (GRCm39) G104S probably benign Het
Tmem121b T C 6: 120,469,055 (GRCm39) E554G probably damaging Het
Tor1aip2 A G 1: 155,940,888 (GRCm39) H398R probably benign Het
Tram2 C T 1: 21,083,673 (GRCm39) V83I probably benign Het
Ube3a C T 7: 58,935,811 (GRCm39) T565I probably damaging Het
Ubr4 T C 4: 139,108,164 (GRCm39) V56A possibly damaging Het
Vmn1r128 T C 7: 21,083,644 (GRCm39) V116A possibly damaging Het
Vmn1r170 C T 7: 23,306,087 (GRCm39) T163I probably benign Het
Vmn2r75 T A 7: 85,813,290 (GRCm39) D504V possibly damaging Het
Vps36 G A 8: 22,708,436 (GRCm39) M363I probably benign Het
Wdsub1 A G 2: 59,708,661 (GRCm39) S71P probably damaging Het
Zdhhc12 A G 2: 29,981,496 (GRCm39) F189L probably benign Het
Zfp521 T C 18: 13,977,387 (GRCm39) M1009V probably benign Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 42,931,920 (GRCm39) missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42,893,296 (GRCm39) missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42,901,351 (GRCm39) missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 42,934,137 (GRCm39) missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42,883,563 (GRCm39) missense probably benign
IGL02135:Arhgef12 APN 9 42,883,461 (GRCm39) missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 42,912,748 (GRCm39) missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42,893,339 (GRCm39) missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42,903,859 (GRCm39) missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 42,916,919 (GRCm39) missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 42,917,200 (GRCm39) nonsense probably null
IGL02803:Arhgef12 APN 9 42,883,324 (GRCm39) missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 42,912,268 (GRCm39) missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 42,927,216 (GRCm39) missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42,910,373 (GRCm39) missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 42,937,524 (GRCm39) missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42,885,866 (GRCm39) missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42,903,829 (GRCm39) splice site probably benign
IGL03398:Arhgef12 APN 9 42,889,522 (GRCm39) missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42,889,529 (GRCm39) missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 42,916,890 (GRCm39) missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42,883,300 (GRCm39) missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 42,931,982 (GRCm39) missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 42,929,697 (GRCm39) missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42,882,286 (GRCm39) splice site probably null
R0658:Arhgef12 UTSW 9 42,893,281 (GRCm39) missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42,904,324 (GRCm39) missense probably benign 0.02
R0693:Arhgef12 UTSW 9 42,929,697 (GRCm39) missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42,883,677 (GRCm39) missense probably benign 0.00
R1147:Arhgef12 UTSW 9 42,955,552 (GRCm39) unclassified probably benign
R1395:Arhgef12 UTSW 9 42,917,166 (GRCm39) missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 42,938,516 (GRCm39) missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42,903,874 (GRCm39) splice site probably benign
R1458:Arhgef12 UTSW 9 42,900,294 (GRCm39) missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42,908,956 (GRCm39) missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 42,932,013 (GRCm39) makesense probably null
R1773:Arhgef12 UTSW 9 42,916,838 (GRCm39) critical splice donor site probably null
R1895:Arhgef12 UTSW 9 42,917,152 (GRCm39) missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42,890,768 (GRCm39) missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 42,917,167 (GRCm39) missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 42,912,302 (GRCm39) missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 42,916,847 (GRCm39) missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42,886,588 (GRCm39) missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42,886,588 (GRCm39) missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42,883,570 (GRCm39) missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 42,929,645 (GRCm39) nonsense probably null
R4327:Arhgef12 UTSW 9 42,886,525 (GRCm39) nonsense probably null
R4462:Arhgef12 UTSW 9 42,893,278 (GRCm39) missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 42,921,489 (GRCm39) missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42,893,266 (GRCm39) missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42,883,449 (GRCm39) missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 42,931,992 (GRCm39) missense probably benign
R4840:Arhgef12 UTSW 9 42,886,364 (GRCm39) missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42,904,361 (GRCm39) nonsense probably null
R5176:Arhgef12 UTSW 9 42,931,982 (GRCm39) missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42,897,880 (GRCm39) missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 42,921,489 (GRCm39) missense probably benign 0.27
R5838:Arhgef12 UTSW 9 42,916,904 (GRCm39) missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42,900,261 (GRCm39) missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42,883,503 (GRCm39) missense probably benign 0.05
R6959:Arhgef12 UTSW 9 42,927,249 (GRCm39) missense probably benign
R7252:Arhgef12 UTSW 9 42,927,205 (GRCm39) missense probably benign 0.17
R7470:Arhgef12 UTSW 9 42,951,848 (GRCm39) missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42,903,832 (GRCm39) missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 42,938,567 (GRCm39) missense probably damaging 1.00
R7980:Arhgef12 UTSW 9 42,882,595 (GRCm39) nonsense probably null
R8074:Arhgef12 UTSW 9 42,882,399 (GRCm39) nonsense probably null
R8155:Arhgef12 UTSW 9 42,953,958 (GRCm39) missense probably damaging 1.00
R8270:Arhgef12 UTSW 9 42,882,354 (GRCm39) missense probably benign
R8407:Arhgef12 UTSW 9 42,937,475 (GRCm39) critical splice donor site probably null
R8527:Arhgef12 UTSW 9 42,908,944 (GRCm39) missense possibly damaging 0.95
R9116:Arhgef12 UTSW 9 42,893,241 (GRCm39) splice site probably benign
R9127:Arhgef12 UTSW 9 42,885,870 (GRCm39) missense possibly damaging 0.94
R9602:Arhgef12 UTSW 9 42,895,676 (GRCm39) missense probably damaging 1.00
R9665:Arhgef12 UTSW 9 42,929,650 (GRCm39) missense possibly damaging 0.89
R9733:Arhgef12 UTSW 9 42,901,294 (GRCm39) nonsense probably null
R9735:Arhgef12 UTSW 9 42,882,399 (GRCm39) nonsense probably null
R9760:Arhgef12 UTSW 9 42,903,318 (GRCm39) missense probably damaging 1.00
RF020:Arhgef12 UTSW 9 42,901,285 (GRCm39) missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42,882,368 (GRCm39) missense probably benign 0.00
Z1186:Arhgef12 UTSW 9 42,911,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGAGACAATAGGCACATTTC -3'
(R):5'- GTAGCTCTCAGATGATGCCC -3'

Sequencing Primer
(F):5'- GAGACAATAGGCACATTTCATTCAC -3'
(R):5'- CTCAGATGATGCCCCCATG -3'
Posted On 2015-09-24