Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Thbs1'

34387

Institutional Source

Beutler Lab

Gene Symbol

Thbs1

Ensembl Gene

ENSMUSG00000040152

Gene Name

thrombospondin 1

Synonyms

TSP-1, TSP1, tbsp1, Thbs-1

MMRRC Submission

038356-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118111876-118127133 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 118123914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039559]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000039559

SMART Domains

Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TSPN	24	221	2.68e-60	SMART
low complexity region	237	249	N/A	INTRINSIC
coiled coil region	292	315	N/A	INTRINSIC
VWC	319	373	3.6e-20	SMART
TSP1	383	430	4.21e-12	SMART
TSP1	439	491	3.04e-18	SMART
TSP1	496	548	8.6e-18	SMART
EGF	551	588	3.88e-3	SMART
EGF	592	646	1.69e1	SMART
EGF	650	691	7.13e-2	SMART
Pfam:TSP_3	728	763	5.8e-12	PFAM
Pfam:TSP_3	763	786	2.1e-5	PFAM
Pfam:TSP_3	787	822	3.3e-13	PFAM
Pfam:TSP_3	822	845	1.1e-6	PFAM
Pfam:TSP_3	846	883	2e-15	PFAM
Pfam:TSP_3	884	919	8.3e-13	PFAM
Pfam:TSP_3	920	954	4.9e-10	PFAM
Pfam:TSP_C	973	1170	1.4e-99	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142588

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190311

Meta Mutation Damage Score

0.9577

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Thbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Thbs1	APN	2	118122973	missense	probably damaging	1.00
IGL00920:Thbs1	APN	2	118113201	missense	probably damaging	0.99
IGL01295:Thbs1	APN	2	118118327	missense	possibly damaging	0.88
IGL01649:Thbs1	APN	2	118114982	missense	probably benign
IGL02077:Thbs1	APN	2	118113110	missense	probably benign	0.00
IGL02251:Thbs1	APN	2	118113518	missense	probably benign	0.00
IGL02263:Thbs1	APN	2	118119880	missense	probably benign	0.06
IGL02392:Thbs1	APN	2	118114660	missense	probably benign
IGL02393:Thbs1	APN	2	118123099	missense	possibly damaging	0.87
IGL02411:Thbs1	APN	2	118114970	missense	probably benign
IGL02659:Thbs1	APN	2	118114792	missense	probably benign	0.29
Stark	UTSW	2	118121237	critical splice donor site	probably null
R0014:Thbs1	UTSW	2	118113350	missense	possibly damaging	0.51
R0042:Thbs1	UTSW	2	118122877	missense	probably damaging	1.00
R0240:Thbs1	UTSW	2	118114393	missense	probably damaging	1.00
R0240:Thbs1	UTSW	2	118114393	missense	probably damaging	1.00
R0316:Thbs1	UTSW	2	118117574	missense	probably damaging	1.00
R0393:Thbs1	UTSW	2	118112991	missense	possibly damaging	0.69
R0678:Thbs1	UTSW	2	118122906	missense	probably damaging	1.00
R1037:Thbs1	UTSW	2	118123051	missense	probably damaging	1.00
R1440:Thbs1	UTSW	2	118114355	missense	probably damaging	1.00
R1454:Thbs1	UTSW	2	118122672	missense	probably damaging	1.00
R1571:Thbs1	UTSW	2	118119197	missense	probably damaging	0.99
R1702:Thbs1	UTSW	2	118113442	missense	probably benign
R2035:Thbs1	UTSW	2	118118340	critical splice donor site	probably null
R2068:Thbs1	UTSW	2	118123537	nonsense	probably null
R2171:Thbs1	UTSW	2	118122579	missense	probably damaging	1.00
R2844:Thbs1	UTSW	2	118117628	missense	probably benign	0.00
R2870:Thbs1	UTSW	2	118119378	missense	probably damaging	1.00
R2870:Thbs1	UTSW	2	118119378	missense	probably damaging	1.00
R3620:Thbs1	UTSW	2	118121159	missense	probably benign	0.05
R3621:Thbs1	UTSW	2	118121159	missense	probably benign	0.05
R3726:Thbs1	UTSW	2	118114710	missense	probably benign	0.02
R4499:Thbs1	UTSW	2	118119950	missense	possibly damaging	0.82
R4524:Thbs1	UTSW	2	118122979	missense	probably damaging	1.00
R4576:Thbs1	UTSW	2	118119416	missense	probably damaging	0.97
R4596:Thbs1	UTSW	2	118114755	missense	possibly damaging	0.80
R4646:Thbs1	UTSW	2	118118329	missense	probably benign	0.15
R4783:Thbs1	UTSW	2	118114792	missense	probably benign	0.04
R4836:Thbs1	UTSW	2	118115018	missense	possibly damaging	0.91
R4943:Thbs1	UTSW	2	118113449	missense	probably damaging	1.00
R4967:Thbs1	UTSW	2	118114778	missense	probably benign
R5014:Thbs1	UTSW	2	118120037	critical splice donor site	probably null
R5062:Thbs1	UTSW	2	118121237	critical splice donor site	probably null
R5363:Thbs1	UTSW	2	118122666	missense	probably damaging	1.00
R5420:Thbs1	UTSW	2	118113155	missense	possibly damaging	0.83
R5432:Thbs1	UTSW	2	118114683	missense	probably benign	0.25
R5788:Thbs1	UTSW	2	118122508	missense	probably damaging	1.00
R6221:Thbs1	UTSW	2	118119997	missense	probably damaging	1.00
R6327:Thbs1	UTSW	2	118112656	missense	unknown
R6466:Thbs1	UTSW	2	118119847	missense	probably damaging	1.00
R6480:Thbs1	UTSW	2	118119117	missense	probably damaging	1.00
R6794:Thbs1	UTSW	2	118120038	splice site	probably null
R6983:Thbs1	UTSW	2	118119952	missense	probably damaging	1.00
R7284:Thbs1	UTSW	2	118119356	missense	probably damaging	1.00
R7320:Thbs1	UTSW	2	118114957	missense	possibly damaging	0.80
R7467:Thbs1	UTSW	2	118118200	missense	probably damaging	1.00
R7542:Thbs1	UTSW	2	118121174	missense	probably damaging	1.00
R7552:Thbs1	UTSW	2	118113362	missense	possibly damaging	0.90
R7575:Thbs1	UTSW	2	118122928	missense	probably damaging	1.00
R7870:Thbs1	UTSW	2	118115027	missense	possibly damaging	0.46
R7943:Thbs1	UTSW	2	118119617	splice site	probably null
R8267:Thbs1	UTSW	2	118122513	missense	probably damaging	1.00
R8402:Thbs1	UTSW	2	118115878	missense	possibly damaging	0.88
R8672:Thbs1	UTSW	2	118113238	missense	probably benign
R8726:Thbs1	UTSW	2	118119476	critical splice donor site	probably null
R8784:Thbs1	UTSW	2	118113132	missense	probably damaging	0.99
R9010:Thbs1	UTSW	2	118122564	missense	probably damaging	1.00
R9353:Thbs1	UTSW	2	118122570	missense	probably damaging	1.00
R9416:Thbs1	UTSW	2	118117502	missense	probably benign	0.11
R9474:Thbs1	UTSW	2	118120037	critical splice donor site	probably null
R9544:Thbs1	UTSW	2	118123451	missense	probably damaging	1.00
R9663:Thbs1	UTSW	2	118119416	missense	probably damaging	0.97
R9701:Thbs1	UTSW	2	118120235	missense	probably benign	0.05
RF039:Thbs1	UTSW	2	118122865	critical splice acceptor site	probably benign
RF054:Thbs1	UTSW	2	118122865	critical splice acceptor site	probably benign
X0019:Thbs1	UTSW	2	118112982	missense	probably damaging	1.00
Z1176:Thbs1	UTSW	2	118113479	missense	probably benign	0.34
Z1176:Thbs1	UTSW	2	118120977	missense	probably benign	0.25
Z1176:Thbs1	UTSW	2	118122922	missense	probably damaging	1.00
Z1177:Thbs1	UTSW	2	118117658	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGGCAGCTTCAGTCACTTCAAAC -3'
(R):5'- TGTCATAGATGGGTCCCGAGTCAG -3'

Sequencing Primer
(F):5'- GCTTCAGTCACTTCAAACAAATC -3'
(R):5'- CCGAGTCAGCCATGATTTTC -3'

Posted On

2013-05-09