Mutagenetix > Incidental Mutation

Incidental Mutation 'R4584:Cdk5rap2'

343898

Institutional Source

Beutler Lab

Gene Symbol

Cdk5rap2

Ensembl Gene

ENSMUSG00000039298

Gene Name

CDK5 regulatory subunit associated protein 2

Synonyms

2900018K03Rik, an

MMRRC Submission

041805-MU

Accession Numbers

Genbank: NM_145990.3

Essential gene?

Possibly non essential (E-score: 0.428) question?

Stock #

R4584 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70216856-70410443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 70266760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 1151 (V1151G)

Ref Sequence

ENSEMBL: ENSMUSP00000119891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]

AlphaFold

Q8K389

Predicted Effect

probably benign
Transcript: ENSMUST00000076541

Predicted Effect

probably benign
Transcript: ENSMUST00000138561

SMART Domains

Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

Domain	Start	End	E-Value	Type
Blast:BRLZ	228	284	1e-13	BLAST
low complexity region	297	314	N/A	INTRINSIC
low complexity region	368	386	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000144099
AA Change: V1151G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: V1151G

Domain	Start	End	E-Value	Type
Pfam:Cnn_1N	58	130	3.6e-26	PFAM
coiled coil region	210	345	N/A	INTRINSIC
low complexity region	368	381	N/A	INTRINSIC
coiled coil region	388	462	N/A	INTRINSIC
coiled coil region	569	616	N/A	INTRINSIC
low complexity region	761	776	N/A	INTRINSIC
low complexity region	791	800	N/A	INTRINSIC
coiled coil region	960	1001	N/A	INTRINSIC
coiled coil region	1112	1140	N/A	INTRINSIC
coiled coil region	1200	1237	N/A	INTRINSIC
Blast:BRLZ	1479	1535	6e-13	BLAST
low complexity region	1548	1565	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
low complexity region	1811	1822	N/A	INTRINSIC

Meta Mutation Damage Score

0.1849

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (86/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	A	G	8: 120,160,017	N343D	probably damaging	Het
9530002B09Rik	T	A	4: 122,701,186	D78E	possibly damaging	Het
A2m	C	A	6: 121,657,406	D632E	probably benign	Het
Alpk2	A	G	18: 65,306,964	S453P	probably damaging	Het
Birc2	A	T	9: 7,833,674	F269I	probably damaging	Het
Ccdc66	G	A	14: 27,500,511	P92S	probably benign	Het
Cdc34	T	A	10: 79,688,035	D108E	possibly damaging	Het
Cemip	T	C	7: 83,958,539	K753R	probably damaging	Het
Cep295	A	T	9: 15,334,799	L787Q	possibly damaging	Het
Cideb	T	C	14: 55,758,270	N8S	probably benign	Het
Dagla	A	G	19: 10,271,009	Y96H	probably damaging	Het
Dapl1	C	A	2: 59,504,742	T80K	possibly damaging	Het
Ddx6	T	C	9: 44,624,487	V171A	probably damaging	Het
Dnah12	C	A	14: 26,772,594	T34K	probably damaging	Het
Dnhd1	T	C	7: 105,678,049	L735P	probably damaging	Het
Ep400	T	A	5: 110,733,897		probably benign	Het
Erlin1	G	T	19: 44,069,319	Y22*	probably null	Het
Gm11127	A	T	17: 36,057,667	M123K	probably damaging	Het
Gm13212	T	A	4: 145,617,177		probably null	Het
Gm5771	T	C	6: 41,396,767	L188P	probably benign	Het
Gmcl1	A	G	6: 86,722,623	S141P	probably damaging	Het
Gtf2a1	C	T	12: 91,562,926	V338I	possibly damaging	Het
Ighv1-66	T	A	12: 115,593,396	Q22L	possibly damaging	Het
Igkv4-80	T	C	6: 69,016,736	Y57C	probably damaging	Het
Itpk1	G	A	12: 102,570,157	A410V	possibly damaging	Het
Itsn1	T	A	16: 91,820,583		probably benign	Het
Kcnk3	G	T	5: 30,588,386	A24S	probably damaging	Het
Kif20a	A	G	18: 34,632,611	Y887C	probably damaging	Het
Klf13	T	C	7: 63,937,970	T193A	possibly damaging	Het
Klhl9	G	T	4: 88,721,907	H32Q	probably damaging	Het
Kndc1	C	G	7: 139,901,243	P82A	probably damaging	Het
Llgl1	T	A	11: 60,712,082	L861Q	probably damaging	Het
Lpcat2	A	G	8: 92,889,371	E305G	probably damaging	Het
Mib2	C	A	4: 155,657,287	A293S	probably damaging	Het
Mtfr1	A	G	3: 19,215,602	E138G	probably damaging	Het
Myoz1	A	G	14: 20,650,595	W185R	probably damaging	Het
Ninj1	T	A	13: 49,193,966		probably null	Het
Nlgn2	A	T	11: 69,834,278	V54E	possibly damaging	Het
Nlrc5	A	C	8: 94,477,275	I668L	probably damaging	Het
Npy6r	T	A	18: 44,276,195	C228S	probably damaging	Het
Nufip2	T	C	11: 77,741,728	V690A	unknown	Het
Nup107	T	C	10: 117,766,368	I513M	probably benign	Het
Oit3	T	C	10: 59,425,462	D461G	probably damaging	Het
Olfr324	T	A	11: 58,598,004	F205I	probably benign	Het
Paxbp1	T	C	16: 91,034,123	D455G	probably damaging	Het
Pcdh7	A	T	5: 57,721,283	T727S	probably damaging	Het
Pex14	G	A	4: 148,970,596	A113V	probably damaging	Het
Phc3	A	G	3: 30,965,882	V23A	possibly damaging	Het
Plec	T	C	15: 76,231,206	D56G	possibly damaging	Het
Plekha7	C	A	7: 116,237,533		probably benign	Het
Prdm16	T	C	4: 154,337,683	E885G	probably damaging	Het
Psd2	A	G	18: 36,012,828	T762A	probably benign	Het
Psme4	T	A	11: 30,834,318	H964Q	probably damaging	Het
Rbak	C	T	5: 143,176,123	V51I	probably benign	Het
Rbfa	A	G	18: 80,200,506	L15P	probably benign	Het
Ren1	T	C	1: 133,354,808	Y84H	probably damaging	Het
Rps6ka5	A	T	12: 100,581,318	I311N	probably damaging	Het
Samd14	T	A	11: 95,021,535		probably null	Het
Scaf4	T	C	16: 90,229,515		probably benign	Het
Serpina12	A	T	12: 104,038,352	L7Q	unknown	Het
Serpinb9d	A	T	13: 33,200,616	E192V	probably damaging	Het
Slc22a29	A	T	19: 8,169,291	F382L	probably benign	Het
Snta1	T	A	2: 154,378,115	D375V	probably benign	Het
Stat5b	T	A	11: 100,787,238	Y683F	probably damaging	Het
Strip1	A	T	3: 107,624,503	Y257N	probably benign	Het
Sugp2	A	G	8: 70,251,898	H695R	probably benign	Het
Svep1	T	A	4: 58,068,526	R3087*	probably null	Het
Syngr2	T	C	11: 117,813,121	V138A	probably damaging	Het
Thra	T	C	11: 98,764,484	F397L	probably benign	Het
Tmem45b	T	A	9: 31,428,655	I149F	probably damaging	Het
Tmprss11f	C	T	5: 86,539,694		probably null	Het
Ush2a	C	T	1: 188,451,798	T1433I	probably benign	Het
Vmn2r109	A	T	17: 20,554,558	Y178*	probably null	Het
Vmn2r84	T	G	10: 130,390,713	M419L	probably benign	Het
Wnk2	C	T	13: 49,090,837	D508N	probably damaging	Het
Zfp276	A	G	8: 123,268,406		probably benign	Het
Zfp568	T	G	7: 29,998,192	F100V	probably benign	Het
Zfp667	T	A	7: 6,290,625	D41E	possibly damaging	Het

Other mutations in Cdk5rap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cdk5rap2	APN	4	70403472	critical splice donor site	probably null
IGL01305:Cdk5rap2	APN	4	70380235	missense	possibly damaging	0.52
IGL01987:Cdk5rap2	APN	4	70302082	critical splice donor site	probably null
IGL02213:Cdk5rap2	APN	4	70317602	splice site	probably benign
IGL02732:Cdk5rap2	APN	4	70266665	nonsense	probably null
IGL03063:Cdk5rap2	APN	4	70354877	critical splice acceptor site	probably null
IGL03244:Cdk5rap2	APN	4	70281435	missense	probably benign	0.19
ANU22:Cdk5rap2	UTSW	4	70380235	missense	possibly damaging	0.52
F5426:Cdk5rap2	UTSW	4	70254803	missense	probably benign
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0482:Cdk5rap2	UTSW	4	70410269	start gained	probably benign
R0548:Cdk5rap2	UTSW	4	70349142	critical splice donor site	probably null
R0594:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R0737:Cdk5rap2	UTSW	4	70337375	missense	probably benign	0.01
R0788:Cdk5rap2	UTSW	4	70307231	missense	possibly damaging	0.90
R0960:Cdk5rap2	UTSW	4	70243508	missense	probably benign	0.03
R1682:Cdk5rap2	UTSW	4	70302150	missense	possibly damaging	0.92
R1727:Cdk5rap2	UTSW	4	70272679	missense	probably benign
R1727:Cdk5rap2	UTSW	4	70289972	missense	possibly damaging	0.70
R1768:Cdk5rap2	UTSW	4	70307233	missense	probably benign	0.09
R1903:Cdk5rap2	UTSW	4	70403554	splice site	probably null
R2270:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2271:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2272:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2364:Cdk5rap2	UTSW	4	70360809	critical splice donor site	probably null
R2763:Cdk5rap2	UTSW	4	70281271	missense	probably benign
R2893:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2894:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2958:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2959:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2961:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2962:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2963:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3522:Cdk5rap2	UTSW	4	70250410	missense	probably damaging	1.00
R3725:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3726:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3876:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3919:Cdk5rap2	UTSW	4	70380223	missense	possibly damaging	0.50
R4025:Cdk5rap2	UTSW	4	70250387	missense	probably damaging	0.98
R4324:Cdk5rap2	UTSW	4	70353614	missense	probably damaging	1.00
R4485:Cdk5rap2	UTSW	4	70239283	critical splice donor site	probably null
R4516:Cdk5rap2	UTSW	4	70276715	splice site	probably null
R4556:Cdk5rap2	UTSW	4	70239312	missense	probably damaging	0.97
R4560:Cdk5rap2	UTSW	4	70315331	missense	probably benign	0.03
R4620:Cdk5rap2	UTSW	4	70266706	missense	probably benign	0.00
R4639:Cdk5rap2	UTSW	4	70302176	missense	probably damaging	0.97
R4755:Cdk5rap2	UTSW	4	70238425	missense	probably damaging	1.00
R4947:Cdk5rap2	UTSW	4	70228592	splice site	probably null
R5116:Cdk5rap2	UTSW	4	70307238	missense	possibly damaging	0.67
R5449:Cdk5rap2	UTSW	4	70276651	missense	probably benign	0.00
R5643:Cdk5rap2	UTSW	4	70266733	missense	probably damaging	0.99
R5899:Cdk5rap2	UTSW	4	70243593	splice site	probably benign
R6177:Cdk5rap2	UTSW	4	70281482	missense	probably damaging	0.99
R6254:Cdk5rap2	UTSW	4	70364032	missense	probably damaging	1.00
R6326:Cdk5rap2	UTSW	4	70235454	missense	probably damaging	1.00
R6335:Cdk5rap2	UTSW	4	70266612	missense	possibly damaging	0.79
R6534:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R6857:Cdk5rap2	UTSW	4	70245396	nonsense	probably null
R6959:Cdk5rap2	UTSW	4	70360669	splice site	probably null
R7104:Cdk5rap2	UTSW	4	70349156	missense	probably benign	0.00
R7145:Cdk5rap2	UTSW	4	70238231	missense	probably benign	0.13
R7223:Cdk5rap2	UTSW	4	70235447	missense	probably benign	0.02
R7234:Cdk5rap2	UTSW	4	70376787	splice site	probably null
R7240:Cdk5rap2	UTSW	4	70291908	missense	probably damaging	1.00
R7247:Cdk5rap2	UTSW	4	70337429	missense	probably damaging	1.00
R7382:Cdk5rap2	UTSW	4	70290025	missense	probably benign	0.19
R7413:Cdk5rap2	UTSW	4	70254735	missense	probably damaging	1.00
R7576:Cdk5rap2	UTSW	4	70266872	missense	probably benign	0.01
R8236:Cdk5rap2	UTSW	4	70242485	missense	probably benign
R8434:Cdk5rap2	UTSW	4	70364020	missense	probably benign	0.00
R8688:Cdk5rap2	UTSW	4	70380273	missense	probably damaging	1.00
R8706:Cdk5rap2	UTSW	4	70239325	missense	probably benign	0.08
R8731:Cdk5rap2	UTSW	4	70245510	splice site	probably benign
R8782:Cdk5rap2	UTSW	4	70243475	missense	possibly damaging	0.57
R8855:Cdk5rap2	UTSW	4	70300650	missense	probably damaging	1.00
R8965:Cdk5rap2	UTSW	4	70266805	missense	probably benign	0.30
R9242:Cdk5rap2	UTSW	4	70337346	missense	possibly damaging	0.46
R9308:Cdk5rap2	UTSW	4	70410267	start codon destroyed	probably null	0.99
R9396:Cdk5rap2	UTSW	4	70254666	missense	possibly damaging	0.75
R9396:Cdk5rap2	UTSW	4	70264658	missense	probably damaging	0.97
R9507:Cdk5rap2	UTSW	4	70291873	missense	probably benign
Z1176:Cdk5rap2	UTSW	4	70266743	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGCAGGTCATGGATTTCACC -3'
(R):5'- CTGTTAAAGTCAGCGTGAATGG -3'

Sequencing Primer
(F):5'- GGTCATGGATTTCACCGAAAAGTTCC -3'
(R):5'- TGGAACTGACCAGTCTGAGAATATC -3'

Posted On

2015-09-24